Información

4.4: Algunas mutaciones pueden no tener fenotipos detectables - Biología

4.4: Algunas mutaciones pueden no tener fenotipos detectables - Biología



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Cambios silenciosos

Después del tratamiento con mutágenos, la gran mayoría de los cambios de pares de bases (especialmente sustituciones) no tienen ningún efecto sobre el fenotipo. A menudo, esto se debe a que el cambio se produce en la secuencia de ADN de una región no codificante del ADN, como en regiones intergenicas (entre genes) o dentro de una región intrónica. Además, incluso si el cambio ocurre en una base dentro de un codón, es posible que no cambie el aminoácido que codifica (recuerde que el código genético está degenerado; por ejemplo, GCT, GCC, GCA y GCG todos codifican alanina) y es referido como un silencio mutación. Además, la sustitución de bases puede cambiar un aminoácido, pero esto no altera la función del producto, por lo que no se produciría ningún cambio fenotípico.

Medio ambiente y redundancia genética

También hay situaciones en las que una mutación puede causar la pérdida completa de la función de un gen, pero no producir un cambio en el fenotipo, incluso cuando el alelo mutante es homocigoto. La falta de un cambio fenotípico puede deberse a efectos ambientales: la pérdida de ese producto genético puede no ser evidente en ese entorno, pero sí en otro. Alternativamente, la falta de un fenotipo podría atribuirse a factores genéticos redundancia, es decir, la codificación de genes que funcionan de manera similar en más de un locus del genoma. Así, la pérdida de un gen se compensa con otro. Debe recordarse esta importante limitación del análisis mutacional: los genes con funciones redundantes no pueden identificarse fácilmente mediante el cribado de mutantes.

Genes esenciales y alelos letales

Algunos fenotipos requieren que los individuos alcancen una etapa de desarrollo particular antes de poder calificarlos. Por ejemplo, el color de las flores solo se puede puntuar en plantas que son lo suficientemente maduras para producir flores, y el color de los ojos solo se puede puntuar en las moscas que han desarrollado ojos. Sin embargo, es posible que algunos alelos no se desarrollen lo suficiente como para incluirse entre la progenie que se puntúa para un fenotipo particular. Mutaciones en genes esenciales crear alelos letales recesivos que detienen el desarrollo de un individuo en una etapa embrionaria. Por lo tanto, este tipo de mutación puede pasar desapercibida en un cribado de mutantes típico porque están ausentes en la progenie que se criba. Además, la progenie de un cruce monohíbrido que implica un alelo recesivo letal embrionario puede, por tanto, ser de una sola clase fenotípica, dando una relación fenotípica de 1: 0 (que es lo mismo que 3: 0). En este caso, es posible que no se detecte la mutación.

Nombrar genes

Muchos genes se han identificado por primera vez en las pantallas de mutantes, por lo que tienden a recibir el nombre de sus fenotipos mutantes, no de la función o el fenotipo normal. Esto puede causar cierta confusión a los estudiantes de genética. Por ejemplo, ya nos hemos encontrado con un gen ligado al cromosoma X llamado blanco en moscas de la fruta. Mutantes nulos del blanco gen tiene ojos blancos, pero lo normal blanco+ alelo tiene ojos rojos. Esto nos dice que la función de tipo salvaje (normal) de este gen es en realidad ayudar a producir ojos rojos. Su producto es una proteína que importa un precursor de pigmento a las células en desarrollo del ojo. ¿Por qué no lo llamamos el gen "rojo", ya que eso es lo que hace su producto? Porque hay más de una docena de genes que, cuando son mutantes, alteran el color de los ojos; p.ej. violeta, cinabrio, marrón, escarlata, etc. Para todos estos genes, su función también es necesaria para hacer que el ojo de tipo salvaje sea rojo y no el color mutante. Si usáramos el nombre "rojo" para todos estos genes, sería confuso, por lo que usamos el fenotipo mutante distintivo como nombre del gen. Sin embargo, esto puede ser problemático, como ocurre con las mutaciones "letales" descritas anteriormente. Este problema generalmente se maneja dando números o ubicaciones al nombre del gen, o inventando nombres que describan cómo mueren (p. Ej. incluso salteado, jorobado, peludo, enano, etc.).


Anteriormente examinamos cómo se estudia la composición genética de una población. En este tutorial examinaremos las condiciones que pueden alterar la composición genética. Este tema es fundamental para la evolución. Las poblaciones genéticamente estables (aquellas en equilibrio Hardy-Weinberg) no evolucionan, sin embargo, las poblaciones genéticamente inestables experimentan cambios evolutivos. Examinaremos aquellas condiciones que afectan la estabilidad genética y, por lo tanto, contribuyen al cambio evolutivo. Al final de este tutorial, debe tener un conocimiento básico de:

  • Cómo se relacionan el efecto fundador y el efecto cuello de botella con la deriva genética
  • Cómo el flujo de genes, las mutaciones y el comportamiento de apareamiento pueden afectar la estabilidad genética
  • Cómo la selección puede influir en la frecuencia de los alelos

Proteínas ribosomales: fenotipos mutantes según los números y cambios asociados en la expresión génica

Las proteínas ribosómicas están muy conservadas, muchas de ellas universalmente entre los organismos. Todas las proteínas ribosómicas son partes estructurales de la misma máquina molecular, el ribosoma. Sin embargo, cuando las proteínas ribosómicas se mutan individualmente, a menudo conducen a fenotipos distintos e intrigantes, incluidas patologías humanas específicas. Esta revisión es un intento de recopilar y analizar todos los fenotipos informados de cada mutante de proteína ribosómica en varios eucariotas (Saccharomyces cerevisiae, Caenorhabditis elegans, Drosophila melanogaster, Danio rerio, Mus musculus, Homo sapiens). Estos fenotipos se procesaron con enfoques computacionales no sesgados para revelar asociaciones entre diferentes fenotipos y las contribuciones de genes de proteínas ribosomales individuales. También se presenta una descripción general de los cambios en la expresión génica en mutantes de proteínas ribosómicas, con énfasis en estudios de perfiles de ribosomas. Los datos disponibles apuntan a patrones que pueden explicar la mayoría de los fenotipos observados. La información presentada aquí también puede informar estudios futuros sobre la base molecular de los fenotipos que surgen de mutaciones en proteínas ribosomales.

1. Información general

Los ribosomas son máquinas moleculares complejas que sintetizan proteínas según las instrucciones de la información genética de los ARN mensajeros (ARNm) [1–4]. La mayoría de los fenotipos observados en células y organismos surgen de la función de los polipéptidos que producen los ribosomas. Por tanto, los ribosomas se encuentran en la unión crítica de la relación genotipo-fenotipo en todas las especies. Los ribosomas completamente ensamblados tienen subunidades grandes y pequeñas. Las subunidades pequeñas y grandes de los eucariotas se denominan subunidades 40S y 60S, respectivamente, en función de sus propiedades de sedimentación. 80S se refiere a ribosomas completamente ensamblados. Cada subunidad es una partícula de ribonucleoproteína, compuesta por una (en el 40S) o tres (en el 60S) moléculas de ARN ribosómico (ARNr) y muchas proteínas (79 en levadura, 80 en animales) en los ribosomas 80S. Las proteínas ribosómicas son componentes estructurales no catalíticos de los ribosomas [5,6]. Los ribosomas bacterianos tienen una arquitectura similar, pero son más pequeños y tienen menos proteínas.

La mayoría de las proteínas ribosómicas son esenciales para la función y la vida de los ribosomas. En la levadura en ciernes, 15 de un total de 79 proteínas ribosómicas citoplasmáticas no son esenciales [7]. En varios casos, más de un gen puede codificar una proteína ribosómica. Por ejemplo, en la levadura en ciernes Saccharomyces cerevisiae59 proteínas ribosomales están codificadas en cada caso por un par de genes parálogos muy similares. Como se describirá a continuación (figura 1), las células que portan mutaciones en proteínas ribosomales presentan un amplio espectro de fenotipos, dependiendo del locus y los alelos implicados. El objetivo de esta revisión es repasar sistemáticamente estos fenotipos y examinar cómo podrían surgir.

Figura 1. Resumen de los fenotipos más comunes que surgen de mutaciones con pérdida de función en proteínas ribosomales, en cada uno de los organismos examinados en esta revisión. El número de genes mutantes para los que se han descrito fenotipos se muestra en la segunda columna, mientras que el número total de fenotipos detectados por mutaciones en cualquier gen de la proteína ribosómica en ese organismo se muestra en la tercera columna.

Esta revisión se centra en seis organismos eucariotas, tres invertebrados (levadura en ciernes, gusano, mosca) y tres vertebrados (pez, ratón, humano). Las siguientes secciones describirán lo siguiente: (i) la generación de una matriz completa de fenotipos de pérdida de función de mutantes de proteína ribosómica en cada uno de los seis organismos (ii) un enfoque computacional para definir y agrupar esos fenotipos y los genes que sustentan ellos (iii) un análisis similar para fenotipos de ganancia de función de proteínas ribosomales en levadura (iv) una discusión de la evidencia que vincula en algunos casos mutantes de proteína ribosómica con una mayor proliferación, incluido el cáncer y (v) un examen de los fenotipos observados en el contexto de cambios en la expresión génica, especialmente a nivel de traducción, que pueden tender un puente entre las relaciones genotipo-fenotipo. Por último, vale la pena señalar que todos los conjuntos de datos generados aquí se proporcionan en los archivos adjuntos, con la esperanza de estimular más análisis de las notables propiedades y consecuencias de las perturbaciones de las proteínas ribosómicas.

2. Entrada de datos

Los nombres de los genes de las proteínas ribosómicas consultadas se enumeran en el material complementario electrónico, archivo S1, en hojas de cálculo separadas para cada especie. Para facilitar las comparaciones entre especies, junto al nombre de cada gen se muestra el nuevo nombre unificado de la proteína ribosómica que codifica el gen [8]. Tenga en cuenta que los ribosomas de levadura carecen de la proteína eL28. El nombre de cada gen se utilizó para consultar la base de datos bien curada de cada especie, para recopilar todos los fenotipos disponibles para ese gen en ese organismo: SGD para S. cerevisiae ([9], https://www.yeastgenome.org/) WormBase para Caenorhabditis elegans ([10], https://wormbase.org/) FlyBase para Drosophila melanogaster ([11], https://flybase.org/) ZFIN para Danio rerio ([12], https://zfin.org/) MGI para Mus musculus ([13] http://www.informatics.jax.org/) OMIM para Homo sapiens ([14], https://omim.org/). En su mayor parte, los informes primarios que describen los fenotipos mutantes de la proteína ribosómica no se citaron aquí ni se utilizaron como entrada en las matrices fenotípicas resultantes. En cambio, los fenotipos recopilados fueron solo los incluidos en cada base de datos, con sus descriptores adjuntos. Debido a que la literatura sobre todas estas especies es extensa, esta fue la única forma práctica, imparcial y estandarizada de construir las matrices fenotípicas. Por lo tanto, es posible que existan fenotipos adicionales, que faltaban en las bases de datos seleccionadas consultadas en el momento de preparar esta revisión. No obstante, incluso si existen tales casos faltantes, es poco probable que hayan influido significativamente en el resultado de los análisis, debido a la gran cantidad de puntos de datos que ya están presentes en la base de datos de cada organismo.

La matriz fenotípica para cada especie se ensambló a partir de los archivos de texto individuales descargados que describen los fenotipos asociados con cada gen, como se describió anteriormente [15]. Cada matriz se muestra en una hoja (especies_phenotypes) de un archivo complementario separado para cada especie (por ejemplo, la matriz fenotípica de la levadura está en el material complementario electrónico, el archivo2 / hoja "levadura_fenotipos" el de los gusanos en el material complementario electrónico, el archivo3 / hoja "worm_phenotypes" y así sucesivamente). Para la levadura, se construyó una matriz fenotípica separada para fenotipos de ganancia de función, y se describirá por separado más adelante en este informe.

3. Propiedades generales de las proteínas mutantes ribosómicas

En la figura 1 se ofrece una descripción general de los fenotipos que surgen de mutaciones de pérdida de función en genes de proteínas ribosomales en todas las especies. El número de fenotipos observados fue considerable, pero no todos se observaron en la mayoría de los mutantes de proteínas ribosómicas. Con toda esa información a mano, las dos primeras preguntas obvias son: ¿Cuáles son los fenotipos más comunes en mutantes de proteína ribosómica con pérdida de función y existen patrones comunes entre especies?

En la levadura, 137 genes que codifican proteínas ribosómicas conducen a 111 fenotipos de pérdida de función (material complementario electrónico, file2 / sheet "yeast_phenotypes"). Los tres fenotipos más comunes en este organismo unicelular fueron la disminución de la aptitud competitiva, la disminución de la resistencia a los productos químicos y la disminución del crecimiento vegetativo, observado en el 90%, 89% y 80%, respectivamente, de todos los mutantes con pérdida de función informados. En los gusanos, de los 151 fenotipos observados cuando se mutaron 77 loci, se notificó detención larvaria, letalidad embrionaria y esterilidad materna en más del 84% de todos los mutantes de proteína ribosómica (material complementario electrónico, file3 / sheet "worm_phenotypes"). En las moscas, los fenotipos más comunes no son compartidos por una porción tan grande de mutantes como en las levaduras y los gusanos. No obstante, la letalidad durante la etapa larvaria, la letalidad parcial y los fenotipos Minute se observaron en el 49%, 40% y 35%, respectivamente, de todos los mutantes de la proteína ribosómica (material complementario electrónico, file4 / sheet "fly_phenotypes"). El fenotipo Minute se ha estudiado ampliamente en Drosophila, y durante mucho tiempo se ha reconocido que es el resultado de la progresión del ciclo celular retardado y autónomo de las células y el crecimiento celular deteriorado, lo que conduce a un tamaño celular más pequeño [16]. Existe una relación dosis-respuesta del grado de insuficiencia de la proteína ribosómica y la fuerza del fenotipo Minute [17-19]. En el pez cebra, hay mutantes en aproximadamente la mitad de los genes de las proteínas ribosomales, lo que lleva a más de 200 fenotipos distintos (figura 1). En más de las tres cuartas partes de estos mutantes, los fenotipos más comunes fueron un tamaño de cabeza reducido, un grosor reducido de la extensión de la yema y ojos más pequeños (material complementario electrónico, file5 / sheet "fish_phenotypes"). En ratones, hay mutantes para solo 23 genes de proteínas ribosomales (figura 1). Aunque se han observado 289 fenotipos distintos en estos ratones, los más comunes, que se encuentran en aproximadamente una cuarta parte de estos mutantes, son la disminución del peso corporal, la cola torcida y la letalidad prenatal (material complementario electrónico, file6 / sheet "mouse_phenotypes"). Al ver estos datos completos en su totalidad, queda claro que, desde las levaduras hasta los ratones, los resultados más probables de mutaciones con pérdida de función en los genes de las proteínas ribosomales son: proliferación celular reducida o retardada, tamaño reducido de células, órganos u organismos, retraso en el desarrollo, detención o letalidad (figura 1 material complementario electrónico, archivos 2-6).

En los seres humanos, las mutaciones en 24 genes de proteínas ribosomales están relacionadas con la enfermedad (figura 1). Los pacientes con mutaciones en 18 de estos loci desarrollan diferentes tipos de anemia de Diamond-Blackfan (material electrónico complementario, archivo7 / hoja "human_phenotypes"). Los loci de proteínas ribosomales restantes están asociados con una proliferación deficiente de las células ciliadas (hipotricosis), un crecimiento óseo deficiente (que conduce a displasias y baja estatura), un cráneo más corto (braquicefalia), ausencia de bazo (asplenia), retraso en el desarrollo, anemia macrocítica refractaria, trastornos mentales. retraso o autismo. Aunque las mutaciones de las proteínas ribosómicas se asocian con distintos tipos de anemia de Diamond-Blackfan, en todos los casos hay una falla en la médula ósea para desarrollarse adecuadamente y producir suficientes glóbulos rojos [20]. También hay anomalías adicionales [20], que son consistentes con los fenotipos más comunes observados en los otros sistemas modelo discutidos anteriormente. Por ejemplo, aproximadamente la mitad de los pacientes de Diamond-Blackfan tienen anomalías físicas. Estas anomalías se manifiestan como una cabeza inusualmente pequeña (microcefalia), mandíbula inferior pequeña (micrognatia) y otras malformaciones. Aproximadamente un tercio de las personas afectadas también crecen lentamente y tienen baja estatura. Por tanto, en los seres humanos, como en los diferentes organismos discutidos anteriormente, las manifestaciones fenotípicas típicas de las mutaciones de pérdida de función de la proteína ribosómica son, en esencia, consecuencias de la hipoliferación.

Pero tan satisfactoria como la congruencia de los fenotipos más comunes de mutantes de proteínas ribosomales puede ser de levadura a humanos, esta visión simplifica en exceso la biología subyacente. Sería erróneo concluir que "usted ha visto una proteína ribosómica mutante, las ha visto todas". Después de todo, todavía existe un espectro tan amplio de fenotipos adicionales en cada organismo (material complementario electrónico, archivos 2-7). La aparente multitud de estos fenotipos plantea más preguntas, tales como: para reducir esta complejidad, ¿se pueden identificar fenotipos que se agrupan en diferentes grupos? Si es así, ¿cuáles son los genes de las proteínas ribosomales que impulsan esta clasificación? Responder a estas preguntas puede ofrecer nuevos conocimientos sobre las asociaciones fenotipo-fenotipo y gen-fenotipo entre mutantes de proteínas ribosómicas.

4. Análisis de correspondencia múltiple de fenotipos de proteínas ribosomales

Al tratar los diferentes fenotipos como variables distintas, se podrían aplicar técnicas estadísticas multivariadas ampliamente utilizadas para simplificar las variables fenotípicas relacionadas. Medir el grado en que las variables fenotípicas observadas se correlacionan entre sí proporciona la base para reducirlas. Si dos o más variables fenotípicas comparten algunas características, entonces, según la magnitud y la dirección de la relación, la complejidad observada puede simplificarse. Las técnicas que implementan los principios anteriores incluyen el análisis factorial y el análisis de componentes principales [21]. Para datos categóricos (por ejemplo, la presencia o ausencia de un fenotipo), un enfoque relacionado es el del análisis de correspondencia [22], para detectar y agrupar estructuras subyacentes en las variables fenotípicas dentro de un conjunto de datos [15]. Como resultado, se obtiene una vista de menor dimensión de la estructura interna de los datos. Estos enfoques se pueden aplicar a conjuntos de datos en los que cada mutante muestra al menos algunos fenotipos. Este es el caso de las proteínas ribosómicas mutantes en los organismos modelo que discutimos anteriormente, excepto en los seres humanos. Los términos fenotípicos asociados con casi todos los mutantes de proteínas ribosómicas en humanos son únicos para cada mutante. Para RPL10, hay dos enfermedades asociadas: autismo y displasia espondiloepimetafisaria (material complementario electrónico, archivo7 / hoja "human_phenotypes"). Tenga en cuenta que, aunque las anemias son frecuentes entre los pacientes con mutaciones de la proteína ribosómica, cada locus conduce a un tipo único de anemia de Diamond-Blackfan (material electrónico complementario, file7 / sheet "human_phenotypes"), que se mantuvieron como variables fenotípicas separadas. Por lo tanto, existe una correspondencia casi uno a uno entre una variable fenotípica y el locus de la proteína ribosómica, lo que excluye cualquier intento de reducir la dimensionalidad del conjunto de datos humanos.

Para los fenotipos mutantes de la proteína ribosómica para cada una de las otras especies, se realizó un análisis de correspondencia múltiple (MCA) como se describe en otra parte [15]. El proceso se resume en la figura 2. El porcentaje de la varianza de las primeras 20 dimensiones en cada especie se muestra en las gráficas de la figura 3. En los siguientes párrafos, se describirá lo siguiente para cada especie: (i) el número de las dimensiones / conglomerados que explican la mayor parte de la varianza en los fenotipos observados (ii) los fenotipos que más contribuyen a cada dimensión (la discusión se limitará a aquellos fenotipos con un límite de correlación elegido arbitrariamente ≥ 0,4) y (iii) el genes individuales que contribuyen más a cada dimensión (de nuevo, la discusión se limitará a genes con correlaciones ≥ 0,4). Todos los datos de cada organismo se pueden encontrar en los correspondientes archivos complementarios. Las pantallas separadas (figuras 4 a 9) para cada organismo muestran las dimensiones que fueron impulsadas significativamente por variables fenotípicas específicas y por genes de proteínas ribosómicas específicas (es decir, correlaciones superiores a 0,4 en ambos casos). En general, este enfoque podría ofrecer información valiosa sobre la variación en los datos y reducir la desconcertante complejidad de los fenotipos mutantes de la proteína ribosómica.

Figura 2. Esquema del proceso para reducir la complejidad de los fenotipos observados entre los mutantes de la proteína ribosómica (RP) e identificar los genes que más contribuyen a grupos específicos.

Figura 3. Gráficos de pantalla para las primeras 20 dimensiones en cada especie, mostrando el porcentaje de la varianza explicada por cada dimensión en cada organismo. Para obtener la lista completa de todas las dimensiones, consulte el archivo de material complementario electrónico de cada organismo, en las hojas indicadas como "* _eigen".

Figura 4. Fenotipos que muestran la asociación más significativa con dimensiones / agrupaciones específicas entre mutantes de proteína ribosómica con pérdida de función en levadura. En cada caso se indican las proteínas ribosómicas que impulsan estos agrupamientos.

Figura 5. Fenotipos que muestran la asociación más significativa con dimensiones / agrupaciones específicas entre mutantes de proteína ribosómica con pérdida de función en gusanos. En cada caso se indican las proteínas ribosómicas que impulsan estos agrupamientos. Todas las proteínas mostradas tuvieron contribuciones significativas (coeficientes de correlación & gt 0,4).

Figura 6. Fenotipos que muestran la asociación más significativa con dimensiones / agrupaciones específicas entre mutantes de proteína ribosómica con pérdida de función en moscas. En cada caso se indican las proteínas ribosómicas que impulsan estos agrupamientos.

Figura 7. Fenotipos que muestran la asociación más significativa con dimensiones / agrupaciones específicas entre mutantes de proteína ribosómica con pérdida de función en el pez cebra. En cada caso se indican las proteínas ribosómicas que impulsan estos agrupamientos. Todas las proteínas mostradas tuvieron contribuciones significativas (coeficientes de correlación & gt0.4).

Figura 8. Fenotipos que muestran la asociación más significativa con dimensiones / agrupaciones específicas entre mutantes de proteína ribosómica con pérdida de función en ratones. En cada caso se indican las proteínas ribosómicas que impulsan estos agrupamientos.

Figura 9. Fenotipos que muestran la asociación más significativa con dimensiones / agrupaciones específicas entre mutantes de proteína ribosómica con ganancia de función en levadura. En cada caso se indican las proteínas ribosómicas que impulsan estos agrupamientos. Todas las proteínas mostradas tuvieron contribuciones significativas (coeficientes de correlación & gt0.4).

4.1. Saccharomyces cerevisiae

En la levadura, los 111 fenotipos de pérdida de función podrían reducirse a 11 dimensiones. Juntas, estas 11 dimensiones explicaron el 72% de la varianza en las variables fenotípicas (material complementario electrónico, archivo2 / hoja "yeast_eigen"). En la mayoría de las dimensiones (enumeradas en el material complementario electrónico, file2 / sheets "yeast_Dim"), los fenotipos asociados estaban ampliamente dispersos y no se asociaban fuertemente con una dimensión determinada (es decir, los coeficientes de correlación eran inferiores a 0,4). Tenga en cuenta que los fenotipos más comunes en este organismo (por ejemplo, figura 1 de aptitud reducida) se muestran en más del 80% de los mutantes de la proteína ribosómica. No obstante, notamos que el aumento de la autofagia y la sensibilidad a las feromonas se relacionaron significativamente con la Dimensión 2 (R 2 = 0.58 ver el material complementario electrónico, archivo2 / hoja 'levadura_Dim2'). La dimensión 2 explica el 13% de la varianza entre los 111 fenotipos. El aumento de la sensibilidad a las feromonas probablemente refleja la fase G1 prolongada [23] observada en mutantes de proteínas ribosómicas [24]. La autofagia es una estrategia para obtener los recursos necesarios para mantener cierto grado de proliferación cuando los nutrientes son limitantes o durante otras situaciones de estrés [25]. Por lo tanto, es razonable esperar un aumento de la autofagia en las perturbaciones de las proteínas ribosómicas, que pueden reflejar genéticamente un entorno de estrés pobre en nutrientes.

Un resultado valioso del análisis de correspondencia múltiple descrito anteriormente apunta al gen mutante que impulsa la agrupación de las diversas variables fenotípicas en cada dimensión (enumeradas en el material complementario electrónico, file2 / sheet "yeast_genes_cos2"). Curiosamente, las mutaciones en la proteína ribosómica Asc1p (RACK1 en la nomenclatura unificada) impulsan la agrupación en la Dimensión 2, dominada por una mayor autofagia y sensibilidad a las feromonas (figura 4). Asc1p / RACK1 evita el cambio de marco en los ribosomas en pausa [26]. La pausa del ribosoma a menudo ocurre cuando el suministro de aminoácidos es limitado [27]. La incapacidad de los ribosomas para detenerse adecuadamente, en células que carecen de RACK1, puede imitar las condiciones que inducen la autofagia.

La reducción de la resistencia a los rayos X se asoció fuertemente con la Dimensión 4 (R 2 = 0,69 ver el material complementario electrónico, archivo2 / hoja 'levadura_Dim4'). Esta dimensión solo representa el 7% de la varianza entre todos los fenotipos mutantes de la proteína ribosómica (material complementario electrónico, file2 / sheet "yeast_eigen"), y las mutaciones en eL20 impulsaron ese agrupamiento (figura 4). Curiosamente, sin embargo, esta contribución fue específica de un parálogo (material complementario electrónico, archivo2 / hoja "yeast_genes_cos2"), de RPL20A (R 2 = 0,77), pero no de RPL20B (R 2 = 0,0009). Regresaremos a la cuestión de los fenotipos específicos de parálogos más adelante.

4.2. Caenorhabditis elegans

En los gusanos, los 151 fenotipos de pérdida de función también se redujeron a 11 dimensiones, lo que representa el 76% de la varianza (material complementario electrónico, archivo3 / hoja "worm_eigen"). Al menos tres de las dimensiones fueron impulsadas fuertemente por fenotipos específicos (figura 5). Por ejemplo, la primera dimensión en este organismo metazoario, que representa el 22% de la varianza entre todas las variables fenotípicas, es una mezcla de manifestaciones celulares, tisulares y orgánicas de hipoproliferación, que incluyen células y núcleos pequeños, tejidos pequeños o ausentes. , y un estrechamiento del eje central del cuerpo (figura 5 material complementario electrónico, archivo3 / hoja 'worm_Dim1'). Por último, los genes de proteínas ribosomales que se asociaron de manera más significativa con estos grupos fenotípicos (figura 5), ​​codificaron principalmente proteínas de la subunidad ribosómica grande (uL13, eL28, eL43, uL4, material complementario electrónico uL23, file3 / sheet 'worm_genes_cos2').

4.3. Drosophila melanogaster

En las moscas, la agrupación de los 43 fenotipos de pérdida de función en ocho dimensiones explicó el 78% de la varianza (material complementario electrónico, archivo4 / hoja "fly_eigen"). Al igual que en los gusanos, las manifestaciones hipoproliferativas, como el crecimiento celular defectuoso, el ciclo celular, la fertilidad reducida o la letalidad, dominaron los diferentes grupos (figura 6). La excepción fue la Dimensión 7, que representa el 6% de la varianza fenotípica total, que estuvo dominada por la capacidad de algunos, pero no todos, los alelos uL10 para suprimir la variegación (material complementario electrónico, archivo4 / hoja "fly_Dim7"). Vale la pena señalar que los defectos del ciclo celular dominaron la Dimensión 5, impulsados ​​por un mutante RpS2 / uS5 (material electrónico complementario, archivo4 / hoja "fly_Dim5").

4.4. Danio rerio

En los peces, el número de variables fenotípicas observadas en mutantes de proteínas ribosomales se expande significativamente (figura 1), lo que refleja la complejidad adicional de la biología de los vertebrados. Sin embargo, sorprendentemente, todos estos fenotipos podrían reducirse a solo cinco dimensiones, capturando el 86% de la varianza (material complementario electrónico, archivo5 / hoja "fish_eigen"). Una lista detallada de los fenotipos y genes que están asociados de manera más significativa con cada dimensión se encuentra en el material complementario electrónico, file5. También se resumen esquemáticamente en la figura 7. Los fenotipos típicos de hipoproliferación mostrados en los otros sistemas modelo discutidos hasta ahora, también son evidentes en los peces.

Además, la hematopoyesis definitiva interrumpida y la morfogénesis defectuosa del neurocráneo se asociaron estrechamente con la Dimensión 5 (figura 7, material complementario electrónico, archivo5 / hoja "fish_Dim5"). Como se mencionó anteriormente, estos son fenotipos que también se observan en pacientes humanos con anemias de Diamond-Blackfan (material electrónico complementario, file7 / sheet "human_phenotypes"). El gen que impulsa esta agrupación en peces es rpl5a/ uL18 (material complementario electrónico, archivo5 / hoja "fish_Dim5"). Mutaciones en el ortólogo humano, RPL5/ uL18, conducen a anemia de Diamond-Blackfan tipo 6. Por último, cabe señalar que a nivel celular, el aumento de la autofagia se asoció significativamente con la Dimensión 3 en peces (figura 7), como se observó para una de las dimensiones en levadura (figura 3). En general, las observaciones anteriores ofrecen ejemplos notables de la conservación de las manifestaciones fenotípicas de las perturbaciones de las proteínas ribosómicas en múltiples especies.

4.5. Mus musculus

En ratones, hay 23 mutantes de proteína ribosómica reportados, que muestran 289 variables fenotípicas asombrosas distintas (figura 1 material complementario electrónico, file6 / hoja "mouse_phenotypes"). Sin embargo, todos estos fenotipos podrían agruparse en solo tres dimensiones, lo que explica el 83% de la varianza observada (material complementario electrónico, archivo6 / hoja "mouse_eigen"). Los fenotipos y genes que están asociados más significativamente con cada dimensión están en el material complementario electrónico, archivo6 y se muestran esquemáticamente en la figura 8. Como se discutió anteriormente para peces y humanos, las anomalías esqueléticas también son prominentes en mutantes de proteína ribosómica de ratón.

5. Fenotipos de ganancia de función de proteínas ribosomales en levadura

En la levadura, hay 24 fenotipos informados asociados con la sobreexpresión de 75 genes de proteínas ribosomales (material complementario electrónico, file2 / sheet "yeast_gof_phenotypes"). Los fenotipos más comunes fueron cambios en la tasa de crecimiento vegetativo, que aumentado para 32 genes pero disminuido para otros 19. Para cuatro genes (RPL24B, RPL34A, RPL37B, RPS22B), hubo informes contradictorios de que el crecimiento vegetativo aumentó o disminuyó (material complementario electrónico, archivo2 / hoja "yeast_gof_phenotypes"). Los 24 fenotipos asociados con la sobreexpresión de proteínas ribosómicas podrían agruparse en tres dimensiones, lo que explica el 61% de la varianza observada (material complementario electrónico, archivo2 / hoja "levadura_gof_eigen"). La dimensión 1, que representa el 43% de la varianza total, está impulsada por la morfología anormal y la progresión del ciclo celular en G2. La levadura muestra patrones característicos de crecimiento polarizado y gemación cuando prolifera, que se vieron afectados por la expresión de la proteína ribosomal ectópica, especialmente de RPS7A / eS7 (figura 9, material complementario electrónico, archivo2 / hoja "levadura_gof_genes_cos2"). Numerosos genes, que codifican proteínas de las subunidades ribosómicas grandes y pequeñas, contribuyeron a la Dimensión 2, caracterizada por un mayor crecimiento vegetativo (figura 9). El crecimiento invasivo en la levadura también se asocia con el crecimiento polarizado [28]. La ausencia de crecimiento invasivo impulsó la agrupación en la Dimensión 3 (figura 9). Por tanto, parece haber un patrón general de crecimiento polarizado alterado cuando las proteínas ribosómicas se sobreexpresan en la levadura.

6. Sobreproliferación en mutantes de proteínas ribosómicas

El aumento de la proliferación observado cuando al menos algunas proteínas ribosómicas se sobreexpresan en la levadura es intrigante, pero también desconcertante. No se sabe si esos efectos son reflejos de la producción ribosómica o de alguna función extrarribosómica desconocida. Incluso si el aumento de la proliferación celular se asocia con funciones ribosómicas y más síntesis de proteínas, no está claro cómo la sobreexpresión de un solo componente de una máquina molecular gigante hecha de muchas partes podría impulsar la formación de más máquinas de este tipo. Sin embargo, un informe reciente en ratones argumentó que la sobreexpresión de RPL15 (eL15) no solo mejoró la traducción de otros genes, incluidos los reguladores del ciclo celular, sino que también promovió metástasis a distancia en ratones con cáncer de mama [29].

El aumento de la proliferación y el cáncer también se han asociado con mutaciones de proteínas ribosómicas con pérdida de función. Como se discutió anteriormente, las ribosomopatías en las primeras etapas de la vida son compatibles con la hipoproliferación, como la hematopoyesis defectuosa en las anemias de Diamond-Blackfan [30]. Paradójicamente, más adelante en la vida, algunos de estos pacientes están predispuestos al cáncer [30,31]. El diez por ciento de las muestras humanas primarias de leucemia linfoblástica aguda de células T tienen mutaciones con pérdida de función en RPL22/ eL22 [32]. RPL22 También se encuentran mutaciones en cánceres colorrectales inestables a microsatélites [33] y de endometrio [33,34], con una frecuencia del 77% y del 50%, respectivamente. Además, se han descrito mutaciones asociadas al cáncer para RPL5 (uL18) [35], RPL10 (UL16) [35], RPL11 (uL5) [36], RPS15 (EE.UU. 19) [37,38], RPS20 (uS10) [39] y RPS14 (EE.UU. 11) [40,41]. Las mutaciones asociadas al cáncer en las proteínas ribosomales son hipomórficas, lo que altera la biogénesis del ribosoma [30]. Incluso una mutación errónea de R98S en RPL10 (uL16) observado en la leucemia de células T, se demostró que afecta la biogénesis de los ribosomas y retrasa la proliferación celular cuando se introduce en células de levadura y de mamíferos [35]. Se ha informado de pruebas de que las proteínas ribosómicas pueden funcionar como supresores tumorales haploinsuficientes en el pez cebra [42] y en las moscas [43-45]. Sin embargo, estos resultados no apoyan necesariamente un papel directo y negativo de la biogénesis del ribosoma en la división celular. De hecho, estos efectos en las moscas se debieron a rutas celulares no autónomas [46-48]. En general, en el contexto de su papel en la síntesis de proteínas, la mayor parte de la evidencia sugiere que el fenotipo inicial tras las perturbaciones de pérdida de función de las proteínas ribosómicas es hipoproliferativo. Entonces, ¿cómo podrían las perturbaciones de las proteínas ribosómicas explicar la proliferación celular descontrolada en el cáncer? Hay al menos tres posibilidades, que no se excluyen entre sí:

Las perturbaciones de las proteínas ribosómicas reducen la concentración de ribosomas activos [49-51], que luego desproporcionadamente afecta la traducción de transcripciones específicas [51,52]. Las proteínas ribosómicas en sí mismas pueden no ser reguladores negativos directos de la división celular, pero en las proteínas mutantes ribosómicas, la traducción de algunos ARNm, quizás algunos con funciones supresoras de tumores, podría reprimirse más que otras transcripciones, preparando el escenario para el cáncer. El trasfondo matemático para este tipo de regulación fue articulado hace mucho tiempo por Lodish [53]. Brevemente, el modelo de Lodish predice efectos específicos de ARNm debido a la relación no lineal entre la eficiencia de traducción y los ribosomas disponibles. Al disminuir el contenido de ribosomas, p. Ej. tras las perturbaciones de las proteínas ribosómicas en las ribosomopatías, los ARNm con características (p. ej., estructura secundaria, marcos de lectura abiertos aguas arriba) que impiden el acceso del ribosoma al codón de inicio principal de un ARNm tendrán una desproporcionadamente menor eficiencia de traducción que otros ARNm. La proposición de que los casos específicos de ARNm de control de la traducción, como predice el modelo de Lodish, pueden respaldar al menos algunos de los fenotipos en las ribosomopatías [51,52], es razonable y sencilla.

Las proteínas ribosómicas podrían tener extraribosomal, funciones no traslacionales [54,55]. La alteración de la biogénesis del ribosoma induce estrés nucleolar porque se acumulan proteínas ribosómicas libres. La pérdida de Rpl22 puede provocar cáncer en ratones al activar la vía NF-κB inducida por estrés, que a su vez desencadena el factor de tallo Lin28B [32]. Cuando se interrumpe el ensamblaje de los ribosomas, algunas de las proteínas ribosómicas liberadas podrían unirse a otros objetivos. Por ejemplo, se ha informado que Rpl5, Rpl11 y Rpl23 estabilizan la proteína p53 inhibiendo la ubiquitina ligasa Mdm2 que degrada p53 [55]. Sin embargo, no está claro cómo este papel extraribosómico podría promover el cáncer, ya que la estabilización del supresor tumoral p53 probablemente sería hipo-proliferativo. Un estudio reciente en células humanas que carecen de Rps25 / eS25 informó que la adaptación celular a la pérdida de proteínas ribosómicas, en lugar del control directo de la traducción, puede impulsar fenotipos que se supone que resultan de la traducción preferencial [56]. En ese escenario, tras la pérdida de eS25, el conjunto de ribosomas celulares estaba bajo un estrés relacionado con su biogénesis y recambio, provocando un cambio de estado celular específico, que a su vez impulsa los fenotipos [56].

Por último, la alteración de las proteínas ribosómicas podría alterar la composición de ribosomas activos [57,58]. Se ha informado de la traducción de ARNm que se basan en ribosomas "especializados", especialmente en neuronas [59]. Sin embargo, no hay ejemplos de transcripciones cuya traducción sea realizada por ribosomas "especializados". y afectados en cánceres debido a perturbaciones de las proteínas ribosómicas.

Independientemente de la validez de cada uno de los modelos anteriores, hasta hace poco, había muy poca información sobre los cambios en la expresión génica en mutantes de proteínas ribosomales y, específicamente, sobre la eficiencia de traducción de todos ARNm en esos entornos. Sin tal conocimiento, es difícil tender un puente sobre la relación genotipo-fenotipo en mutantes de proteínas ribosomales de manera mecánica.Sin embargo, en los últimos 2-3 años, han surgido algunas respuestas, basadas en hallazgos recientes de perfiles de ribosomas en mutantes de proteínas ribosomales, que se discutirán en la siguiente sección.

7. Cambios en la expresión génica en mutantes de proteínas ribosómicas.

Antes de discutir los experimentos de perfiles de ribosomas en mutantes de proteínas ribosomales, debe tenerse en cuenta que se han catalogado algunos cambios en la expresión de productos génicos específicos en algunos de esos mutantes en el pez cebra. Estos datos se encuentran en el material complementario electrónico, archivo5 / hoja "fish_gene_expression". Cubre los cambios informados en los niveles de 36 loci en tres mutantes (rpl11, rpl5a, rps19), que puede ofrecer una idea de los fenotipos observados. En estos casos, sin embargo, no estaba claro cómo se produjeron los cambios en la expresión genética.

La elaboración de perfiles de ribosomas incorpora la secuenciación de próxima generación para cuantificar todos los fragmentos de ARNm unidos a los ribosomas [60-62]. A partir de los datos de ARNseq adjuntos, para cada especie de ARNm, se puede calcular a partir de los niveles de estado estacionario observados de ese ARNm como referencia, si la fracción que se une a los ribosomas es mayor de lo esperado o menor, lo que indica un aumento o disminución , eficiencia traslacional, respectivamente. En células humanas, Khajuria y sus colegas imitaron un ajuste Diamond-Blackfan suprimiendo RPS19 (eS19), RPL5 (uL18), RPS24 (eS24) y RPL11 (uL5) [51]. En todos los casos, las células hematopoyéticas tenían niveles más bajos de ribosomas, pero la composición de los ribosomas no cambió. Las consecuencias de RPL5 y RPS19 A continuación, se analizó la supresión mediante perfiles de ribosomas. Los cambios en la transcripción y traducción fueron similares entre RPL5 y RPS19 mutantes, argumentando que las anemias de Diamond-Blackfan conducen a un conjunto común de cambios moleculares en las células hematopoyéticas humanas. Es importante destacar que la traducción de un subconjunto de transcripciones que normalmente están reguladas al alza en las primeras etapas de la especificación del linaje eritroide, que incluyen GATA1, Que codifica un factor de transcripción que desencadena la diferenciación de células sanguíneas inmaduras, se redujo desproporcionadamente cuando RPL5 y RPS19 fueron reprimidos [51]. La traducción de ARNm que codifican proteínas ribosómicas también fue menor en estos entornos [51].

Un elegante estudio en levaduras también llegó a una conclusión general similar de que niveles más bajos de ribosomas dan como resultado cambios específicos y dependientes de la dosis en la expresión génica [50]. Estos autores analizaron mediante perfiles de ribosomas 14 rpl y 9 rps mutantes, cada uno de los cuales carece de uno de los parálogos que codifican la proteína ribosómica correspondiente. La lectura fenotípica primaria utilizada en ese estudio fue la tasa de crecimiento vegetativo. Sorprendentemente, los patrones de cambios en la expresión génica coincidieron con la tasa de crecimiento de cada mutante [50]. En otras palabras, si un rpl y un rps la deleción tiene un efecto similar sobre la tasa de crecimiento, entonces los cambios asociados en la expresión génica también serían similares. A diferencia de la situación en las células humanas, Cheng y sus colegas encontraron que la traducción de genes involucrados en la biogénesis del ribosoma aumentó (no disminuyó), especialmente en rps mutantes [50].

Además de los efectos generales sobre la tasa de crecimiento, también deben existir efectos más matizados y específicos, por varias razones. En primer lugar, el espectro de los fenotipos observados en las proteínas mutantes ribosómicas es variado y complejo. En segundo lugar, la tasa de crecimiento es un parámetro cuantitativo simple, pero si se utilizan los cambios en la tasa de crecimiento solo como criterio para evaluar los fenotipos de proteínas ribosomales se corre el riesgo de "perder los árboles para el bosque". Las diferentes vías celulares pueden verse afectadas por diferentes mutantes de la proteína ribosómica, pero estas diferentes entradas pueden pasarse por alto si tienen impactos comparables en la tasa de crecimiento. Por ejemplo, algunas proteínas ribosómicas mutantes suelen presentar un retraso del ciclo celular G1 equivalente, pero por diferentes razones [63]. Al menos algunos fenotipos fuertemente asociados con mutaciones de proteínas ribosómicas no se correlacionan en absoluto con efectos dependientes de la dosis sobre la tasa de crecimiento. Un ejemplo así es la longevidad replicativa. Las mutaciones en las proteínas ribosómicas de la subunidad grande (60S) promueven la longevidad en la levadura [7,49,64,65]. La relación entre rpl mutantes y la longevidad es compleja. Por ejemplo, la deleción del doble parálogo de Rpl22 es viable, pero no de larga duración [7]. El soltero rpl22aΔ mutante es longevo, pero rpl22bΔ las células no son de larga duración [7], y no existe relación entre la tasa de crecimiento de rpl mutantes y su longevidad [66].

Otra demostración más del poder de la elaboración de perfiles de ribosomas para proporcionar la base mecanicista de los efectos traslacionales y sus consecuencias fenotípicas proviene de estudios que examinaron pares de parálogos en levaduras, incluido el par Rpl22 [66]. Los autores encontraron un pequeño conjunto (menos de 100) de ARNm que se tradujeron diferencialmente. Estos ARNm se enriquecieron significativamente para transcripciones que codifican enzimas del metabolismo de un carbono. Las mediciones metabolómicas apoyaron la conclusión de que el metabolismo de un carbono está específicamente regulado a la baja en las células que carecen de Rpl22Ap, pero no de Rpl22B, lo que explica todos los fenotipos de rpl22aΔ células, incluso en longevidad [66]. Como en los estudios previos mencionados anteriormente [50,51], no hubo cambios en la composición de ribosomas a granel en rpl22 mutantes [66]. De acuerdo con Cheng et al. [50], en comparación con las células de tipo salvaje, la traducción de las transcripciones que codifican otras proteínas ribosómicas se incrementó en los deletantes del parálogo, aunque la síntesis de proteínas en general se redujo [66]. Parece que las células de levadura intentan compensar su reducida capacidad de síntesis de proteínas aumentando los niveles de componentes individuales del ribosoma. Pero estos esfuerzos no restauran globalmente el defecto de síntesis de proteínas, presumiblemente porque la producción de componentes ribosomales está desequilibrada.

8. Observaciones finales

La imagen general que surge de los estudios de perfiles detallados es sencilla: mutantes de proteínas ribosómicas con pérdida de función → menos ribosomas → menor síntesis de proteínas → hipoproliferación general y control de traducción desproporcionado y dependiente de la dosis de un subconjunto de ARNm. Esta es una visión amplia que se corresponde muy bien con los fenotipos más comunes resumidos anteriormente desde la levadura hasta los humanos (figura 1). Los efectos adicionales, más específicos, que están desacoplados de la tasa de crecimiento, también pueden explicarse mediante el control de la traducción de las transcripciones relevantes [66]. El estrés asociado con la reserva de ribosomas inferior en mutantes de proteínas ribosómicas también puede desencadenar cambios secundarios, lo que lleva a fenotipos asociados al estrés, sin una base de traducción directa [56]. No obstante, a partir de la evidencia recopilada hasta ahora, parece que el variado panorama fenotípico de las proteínas mutantes ribosómicas, desde los fenotipos generales hasta los más peculiares, se debe principalmente a las funciones canónicas de las proteínas ribosómicas en los ribosomas. Los estudios de perfiles no apoyaron mecanismos adicionales de ribosomas especializados con composición alterada o funciones extraribosómicas, pero tampoco se evaluaron explícitamente. Por lo tanto, estas conclusiones deben probarse más y con más detalle. La aplicación de estas metodologías al análisis de más mutantes de proteínas ribosómicas que muestran fenotipos de interés, sin duda avanzará nuestro conocimiento en la relación entre genotipo y fenotipo en las perturbaciones de las proteínas ribosómicas, iluminando su fascinante biología y las funciones más amplias del control de la traducción.


Resultados

Fenotipo clínico.

Estudiamos a 2 hermanos con JRRP, aquí identificados como paciente 1 (P1) y paciente 2 (P2), de ascendencia belga nacidos de padres consanguíneos (primos hermanos) (Fig.1A). No había otros hermanos. P1 desarrolló ronquera y laringitis recurrente a los 5 años. La laringoscopia directa reveló papilomas en glotis y supraglotis (fig.1B). Requirió 8 ablaciones quirúrgicas de lesiones laríngeas durante el año siguiente y sigue requiriendo ablaciones múltiples cada año, con una frecuencia decreciente. P2 desarrolló ronquera poco después del nacimiento y se diagnosticó papilomatosis laríngea a los 20 meses. Su enfermedad ha sido menos grave que la de P1 y ha requerido de 2 a 3 ablaciones por año. Una revisión retrospectiva cuidadosa de su historial médico reveló las mismas anomalías dermatológicas leves en ambos hermanos, incluida una pequeña cantidad de verrugas palmar y plantares, queratosis pilar en la parte inferior de la espalda, glúteos y muslos y atrofodermia vermiculata en la cara, ninguna de las cuales requirió tratamiento médico. (Figura 1B) ver los informes de casos en Apéndice SI para conocer todos los detalles. Las anomalías dermatológicas no se observan típicamente en otros pacientes con JRRP, que está aislado, por lo tanto, estos 2 pacientes tenían una forma sindrómica de JRRP. Los padres no tenían antecedentes médicos notables, específicamente ningún antecedente de PRR o enfermedad dermatológica. Histológicamente, las lesiones de laringe presentaban una morfología papilomatosa con áreas focales de coilocitosis y células binucleadas dispersas, típicas de lesiones en PRR y patognomónicas de infección por VPH (32). (Figura 1C). Los papilomas de P1 (9 muestras) y P2 (2 muestras) dieron negativo para VPH-6 y VPH-11, lo que coincide con estudios de cohortes en las que el VPH no se detecta en todos los pacientes (16 ⇓ ⇓ –19).

Una mutación de sentido erróneo homocigótica privada en hermanos con JRRP y anomalías dermatológicas. (A) Pedigrí mostrando NLRP1 genotipo de individuos. (B) Imágenes clínicas de P1 que muestran (de izquierda a derecha) papilomas de laringe, atrophoderma vermiculata en mejillas, verrugas plantares y queratosis pilar en glúteos y muslos. (C) Micrografías de un papiloma de laringe de P1 que muestran (de izquierda a derecha) la morfología macroscópica de los papilomas, áreas de células binucleadas (Recuadros: agrandado) y áreas focales de coilocitosis (flechas). (D) Representación esquemática de la proteína NLRP1 que muestra los dominios funcionales, la ubicación de las mutaciones T755N de los pacientes (rojo) y la ubicación de las mutaciones NLRP1 descritas anteriormente (azul) y su modo de herencia (AD, AR o codominante [CoD]). (mi) Alineación de secuenciación de proteínas de NLRP1 humana con ortólogos conocidos, que muestra la conservación de T755.

Análisis genético.

Realizamos la secuenciación del exoma completo (WES) en P1, P2 y ambos padres (I.1 y I.2 Fig.1A). WES mostró una alta tasa de homocigosidad en P1 (3.56%) y P2 (5.13%) (33), consistente con la consanguinidad parental conocida. El análisis de componentes principales confirmó la ascendencia europea de los pacientes (33). A la luz de esta consanguinidad, planteamos la hipótesis de que una variante rara, homocigótica en ambos pacientes y heterocigótica en ambos padres, podría ser responsable del fenotipo de los pacientes. Seleccionamos variantes que se predice que darán como resultado una mutación sin sentido, sin sentido, indel o del sitio de empalme con una frecuencia de alelos menor de & lt0.01 en bases de datos públicas (ExAC, 1000 Genomes y NHLBI-ESP6500). Finalmente, excluimos variantes en genes con un Índice de Daño Genético (GDI) & gt13.38 (34), variantes con una puntuación combinada de agotamiento dependiente de la anotación (CADD) menor que el límite de significación de mutación (MSC) (35), y variantes en nuestra lista negra con una frecuencia interna de & gt0.01 (36) (Apéndice SI, Fig. S1A). Esto produjo 5 variantes homocigotas en 5 genes (Apéndice SI, Fig. S1B). Dos de estos estaban presentes en homocigosis en individuos sanos en ExAC, lo que sugiere que no están relacionados con el fenotipo del paciente, otro estaba en un gen desconocido (ZNF417) y otro estaba en un gen implicado en defectos de conducción cardíaca (KCNH2) (37). El mejor candidato era una mutación homocigótica sin sentido en el dominio de unión de nucleótidos, el dominio de pirina de la familia repetida rica en leucina que contiene 1 (NLRP1), c.2819C & gt A (para la variante de transcripción 1 NBCI NM_033004), p.T755N (en el presente documento T755N). La isoforma 1 de NLRP1, compuesta por 1.473 aminoácidos, actúa como sensor del complejo inmune innato conocido como inflamasoma (38) y se expresa en una variedad de tejidos y tipos de células (https://www.proteinatlas.org/ENSG00000091592- NLRP1 /). T755N es ligeramente N-terminal al dominio de repeticiones ricas en leucina (LRR) (Fig.1D). La homocigosidad del alelo NLRP1 T755N en P1 y P2 y su segregación familiar con la enfermedad fue confirmada por secuenciación de Sanger (Apéndice SI, Fig. S1C). El uso de una estrategia de filtrado de variantes similar para el patrón de herencia ligado al X menos probable no produjo ninguna variante candidata (Apéndice SI, Fig. S1D). Del mismo modo, no hubo mutaciones de novo compartidas por los 2 pacientes. Por lo tanto, estos hallazgos sugirieron que la homocigosidad para NLRP1 T755N podría ser la etiología genética de JRRP en P1 y P2.

Genética de poblaciones de NLRP1.

La variante T755N de NLRP1 no se encuentra en ninguna base de datos pública (gnomAD, Bravo / TOPMED) ni en nuestra cohorte interna de & gt5.000 individuos no relacionados con una variedad de enfermedades infecciosas. Se predice que T755N es dañino por CADD, con una puntuación alta de 23,1, por encima del valor de MSC del intervalo de confianza del 99% de 3,313 (35). El residuo T755 de NLRP1 está altamente conservado en todas las especies (Fig.1mi). NLRP1 tiene un GDI de 9.374, lo que indica una cantidad media de carga mutacional en la población general (34), y está bajo una selección negativa de baja a moderada, con un índice de neutralidad McDonald-Kreitman de 0.400 y una puntuación de intolerancia a la variación residual en el percentil 95 de los genes menos intolerantes (39), sin embargo, estudios previos han demostrado que los genes que causan enfermedades autosómicas recesivas no están bajo selección purificadora (40). En gnomAD, hay 40 mutaciones sin sentido encontradas en homocigosis en 1 o más individuos, 23 de los cuales tienen una puntuación CADD mayor que la MSC. No se encuentran variantes de pérdida de función predicha (LOF) en homocigosis en gnomAD, y el pRec (probabilidad de ser intolerante a variantes de LOF homocigotas, pero no heterocigotas) es 0,95 (41). En conjunto, estos hallazgos sugieren que es probable que T755N sea perjudicial para la función de la proteína NLRP1.

NLRP1 T755N es la ganancia de función y reduce el umbral de activación del inflamasoma in vitro.

Recientemente se ha descubierto que las mutaciones de ganancia de función de la línea germinal (GOF) en NLRP1 causan 3 enfermedades mendelianas de la piel. El carcinoma palmoplantar autocurativo múltiple (MSPC), descrito en 3 familias, sigue un patrón de herencia autosómico dominante (AD), con las 3 mutaciones (A54T, A66V y M77T) en el dominio de pirina (PYR) (42, 43) . La queratosis liquenoide crónica familiar (FKLC), descrita en una familia, sigue un patrón de herencia codominante con una mutación (F787_R843del) inmediatamente N terminal al dominio LRR (Fig.1D) (43). La autoinflamación con artritis y disqueratosis (AIADK), descrita en 2 familias, sigue la herencia autosómica recesiva (AR) (R726W) o AD (P1214R), con mutaciones en los dominios N-terminal LRR y función para encontrar (FIIND), respectivamente (44). In vitro, los alelos causantes de enfermedades de MSPC y FKLC muestran una magnitud de GOF similar a pesar de sus diferentes modos de herencia (AD frente a codominante) (43). Debido a que P1 y P2 tenían anomalías cutáneas similares a las observadas en FKLC, planteamos la hipótesis de que NRLP1 T755N también sería GOF.

Primero confirmamos que ambos NLRP1 Los ADNc de tipo salvaje (WT) y T755N se expresaron normalmente transfectándolos en células HEK293T (Fig.2A). Publicado NLRP1 Los alelos GOF oligomerizan espontáneamente e inducen la secreción de IL-1β en queratinocitos (43). Cuando NLRP1 T755N se sobreexpresó en células HEK293T que no expresan otros componentes del inflamasoma, se oligomerizó espontáneamente, de forma similar a las variantes M77T y F787_R843del de NLRP1 GOF descritas anteriormente y en contraste con WT NLRP1 (Fig.2B). Esta oligomerización de T755N es parcialmente dependiente del sitio de autocosección, el aminoácido F1212 dentro del dominio FIIND, ya que la mutación no escindible F1212A redujo la cantidad de NLRP1 T755N oligomerizado (Fig.2B, carril 6). Tomados en conjunto, estos resultados sugieren que el mutante T755N se comporta de una manera similar bioquímicamente con los otros mutantes NLRP1 GOF al causar una mayor activación del inflamasoma a través de la oligomerización espontánea. Además, la sobreexpresión de NLRP1 T755N en queratinocitos inmortalizados condujo a una producción elevada de IL-1β secretada, similar a la de los alelos GOF descritos anteriormente (Fig.2C), que dependía de la escisión, como se observa en otros alelos GOF de NLRP1 (Fig.2C). La magnitud de la ganancia funcional fue similar en los alelos que siguen a AD (M77T), codominante (F787_R843del) y herencia AR (T755N) (Fig.2 B y C). En resumen, estos hallazgos demuestran que NLRP1 T755N puede causar un aumento de la activación del inflamasoma in vitro, lo que sugiere que este alelo es GOF y, por tanto, probablemente patógeno.

NLRP1 T755N es GOF para la activación del inflamasoma. (A) Western blot que muestra una expresión similar de la proteína NLRP1 WT y T755N en células HEK293T. Se muestra una transferencia Western GAPDH como control de carga. La imagen es representativa de 3 experimentos independientes. (B) Western blot para NLRP1 etiquetado con HA después de BN-PAGE o SDS-PAGE convencional y lisados ​​de células HEK293T que sobreexpresan ADNc de NLRP1 WT (2 réplicas), T755N, alelos GOF publicados anteriormente (M77T y F878_R843del), o NLRP1 T755N5 no escindible + F1212A), que demuestra la oligomerización de T755N NLRP1 similar a otras mutaciones de GOF. La transferencia Western GAPDH se muestra como un control de carga. (C) ELISA de IL-1β en sobrenadantes de queratinocitos después de la transfección con alelos NLRP1 que demuestra que T755N es GOF para la producción de IL-1β y que se requiere la escisión en la posición F1212 para la producción de IL-1β. NT, células no transfectadas EV, vector vacío. Los datos son un promedio de 4 réplicas. ***PAG & lt 0,001, ANOVA de 1 vía.

Los queratinocitos primarios de P1 y P2 demuestran la activación espontánea del inflamasoma.

Derivamos líneas celulares de queratinocitos primarios a partir de muestras de biopsia de piel tomadas de P2 e I.1 (NLRP1 genotipos T755N / T755N y WT / T755N, respectivamente). El ARNm y la proteína de NLRP1 se expresaron a niveles similares en P2, I.1 y 3 líneas de queratinocitos primarios de control sanos (Fig.3A), lo que confirma que el alelo NLRP1 T755N se expresa a niveles normales en células heterocigotas sanas y derivadas de pacientes. A continuación, confirmamos que T755N y WT NLRP1 Los ARNm se expresan en queratinocitos en proporción a su genotipo. Clonación de un parcial NLRP1 El ADNc que abarcaba T755 mostró que en células heterocigotas de I.1, aproximadamente el 50% de las transcripciones eran WT y aproximadamente el 50% eran T755N (Fig.3B), lo que sugiere que el ARNm del T755N NLRP1 El alelo se expresa a niveles iguales a WT.Los queratinocitos de P2 e I.1 liberaron IL-1β en los sobrenadantes, lo que sugiere una activación basal del inflamasoma a nivel funcional (Fig.3C). Por el contrario, la liberación de IL-1β basal no se observó en las células de control (Fig.3C). Cuando estas células fueron estimuladas con Val-boroPro (talabostat, un inhibidor de DPP9 que se ha demostrado que activa el inflamasoma NLRP1) (45, 46), los queratinocitos heterocigotos y de control liberaron grandes cantidades de IL-1β, mientras que la liberación de IL-1β en los queratinocitos de P2 se mantuvo sin cambios (Fig.3C). Se observaron resultados similares para IL-18 (Fig.3D). La supresión de la capacidad de respuesta al talabostat en los queratinocitos de P2 sugiere que el mecanismo de GOF en este alelo se debe a una disminución de la inhibición de DPP9. Tomados en conjunto, estos resultados demuestran que los queratinocitos homocigotos para NLRP1 T755N muestran activación del inflamasoma a nivel basal.

Los queratinocitos derivados del paciente muestran una expresión normal de la proteína NLRP1, activación del inflamasoma basal y falta de respuesta a una activación adicional de NLRP1. (A) Western blot (Cima) y qPCR (Fondo) de la expresión de NLRP1 en queratinocitos de P2, padre heterocigoto (I.1) y 3 controles. La imagen es representativa de 3 experimentos independientes. (B) Expresión relativa de las transcripciones de NLRP1 WT, T755N según lo evaluado por clonación TA y secuenciación de Sanger de un NLPR1 ADNc de queratinocitos de control (CTL), padre heterocigoto (I.1) y P2. (Recuadro) Los números corresponden al número de clones únicos secuenciados. (C) IL-1β ELISA de sobrenadantes de queratinocitos que no se trataron o se trataron con 3 µM de talabostat (Val-boroPro) durante 16 h. (D) ELISA de IL-18 de sobrenadantes de queratinocitos que no se trataron o se trataron con 3 µM de talabostat durante 16 h. Las barras representan la media ± 1 DE. Los resultados son representativos de 3 experimentos independientes.

P1 y P2 muestran niveles elevados de citocinas en suero consistentes con la activación espontánea del inflamasoma in vivo.

Probamos si P1 y P2 tenían algún marcador clínico de activación espontánea del inflamasoma. En primer lugar, se analizó el suero del paciente para determinar la elevación de IL-1β e IL-18, las 2 citocinas que pueden producirse con la activación del inflamasoma (47, 48). Ambos pacientes mostraron elevación de IL-18, pero no de IL-1β, en análisis repetidos (Fig.4A), similar a informes previos de pacientes con mutaciones homocigóticas de NLRP1 GOF cerca de la región LRR de la proteína (43, 44). Esta divergencia de elevación de IL-18 e IL-1β en la sangre también se observa en otros trastornos de activación del inflamasoma, como la autoinflamación mediada por NLRC4 (49), y puede ser la base de las diferencias fenotípicas entre los trastornos del inflamasoma y el estadio de la enfermedad (50). Tanto P1 como P2 también mostraron TNF-α elevado, que es inducido por IL-1β e IL-18 en muchos tipos de células y puede mediar en una mayor regulación de los componentes del inflamasoma (51), aunque la IL-6 no estaba elevada (Fig. 4A), como también se observó en el paciente FKLC descrito previamente con una mutación homocigótica NLRP1 F787_R853del GOF (43). La IL-1RA sérica también se elevó en P1 y P2 (Fig.4A), compatible con la activación crónica del inflamasoma. Los niveles séricos de citocinas no estaban elevados en los padres heterocigotos (Apéndice SI, Fig. S2), consistente con la ausencia de manifestaciones clínicas. Estimulación de las células mononucleares de sangre periférica (PBMC) del paciente y del control sano con lipopolisacárido (LPS) o eliminadas por calor Listeria monocytogenes (HKLM), 2 agonistas del receptor tipo Toll que desencadenan la producción de IL-1β de una manera independiente de NLRP1 (52), condujeron a niveles similares de producción de IL-1β en pacientes y controles (Fig.4B), lo que sugiere una respuesta normal a los ligandos TLR. Estos datos demuestran que los sueros de P1 y P2 mostraron signos de activación del inflamasoma in vivo.

Activación del inflamasoma en P1 y P2. (A) Mediciones de Luminex de los niveles séricos de IL-1β, IL-18, IL-1Ra, IL-6 y TNF-α de P1, P2 y 3 controles sanos. Los resultados son representativos de 2 experimentos independientes. (B) ELISA para IL-1β después de la estimulación de PBMC de controles P1, P2 y 2 con ligandos de TLR que inducen IL-1β de una manera independiente de NLRP1 que demuestra la regulación normal de la producción. Las barras representan la media ± 1 DE. Los resultados son representativos de 2 experimentos independientes.


La evaluación genética de un niño con cáncer

Nathaniel H. Robin MD, Anna C.E. Hurst MD, MS, en Genética del cáncer pediátrico, 2018

El examen físico genético

El examen físico genético tiene varias diferencias notables con el examen médico típico. El examen genético se centra en identificar los sutiles hallazgos físicos que representan pistas sobre el síndrome genético subyacente, que se analiza a continuación. Este enfoque se denomina "dismorfología", que es el estudio de la forma anormal con énfasis en las anomalías estructurales del desarrollo. Una evaluación dismorfológica de un niño (o feto o adulto) busca características físicas (o conductuales) inusuales que podrían proporcionar información sobre errores en el desarrollo embriológico o fetal, mayores o menores.

El examen físico minucioso de un genetista incluye la medición de múltiples estructuras y la evaluación observacional de hallazgos dismórficos. Cuando sea posible, las mediciones deben obtenerse y representarse frente a tablas de crecimiento estandarizadas. Referencias como la Manual de medidas físicas 5 contienen descripciones de los métodos mediante los cuales obtener medidas precisas y las tablas de crecimiento adjuntas.

Se recomienda el uso de terminología precisa en la descripción y documentación del examen físico. La terminología preferida actualizada se puede encontrar en una colección de artículos publicados, "Elementos de morfología: terminología de malformaciones humanas", https://elementsofmorphology.nih.gov/, que tenían la intención de desarrollar definiciones precisas y claras para los términos de las craneofacies, manos , y pies.

Para los genetistas, los primeros "signos vitales" son los parámetros de crecimiento, incluida una evaluación cuidadosa de la longitud, el peso y la circunferencia de la cabeza. La maleza o el crecimiento excesivo no solo pueden ser globales, sino que las diferencias de crecimiento regionales también están asociadas con muchos riesgos de cáncer. La macrocefalia es un marcador importante de muchos síndromes genéticos (como PTENtrastornos relacionados o síndrome del carcinoma nevoide de células basales), y la microcefalia se observa en muchos síndromes de deleción cromosómica que pueden afectar regiones que contienen genes de predisposición al cáncer.

La evaluación debe incluir un examen completo de la piel para evaluar la hiperpigmentación o hipopigmentación congénita o adquirida, crecimientos (como lipomas) y telangiectasias. La distribución de los cambios pigmentarios debe examinarse de cerca, ya que la hiperpigmentación estriada es un signo de mosaicismo tisular, lo que indica diferencias genéticas que pueden no identificarse en los análisis de sangre de rutina. El cabello, las uñas y los dientes también deben examinarse de cerca como parte del examen, y / o se debe preguntar a las familias sobre los patrones de crecimiento o cualquier irregularidad que hayan notado. Por ejemplo, varias manchas oscuras alrededor de la boca pueden no parecer importantes en un adolescente con cáncer de colon recién diagnosticado, pero sugieren el diagnóstico de síndrome de Peutz-Jeghers.

El examen restante se realiza mejor de la cabeza a los pies, incluida la cara y las órbitas, las orejas, la nariz, la boca y la mandíbula. El examen ocular debe incluir características periorbitales (distancia entre ojos, tamaño de la fisura palpebral e inclinación) y estructuras oculares (pupilas y fondo de ojo, si es posible). Se debe tener cuidado para evaluar la simetría y la apariencia gestáltica de cómo cada región “encaja” en la apariencia general de la cara. Las mediciones pueden ser extremadamente útiles para determinar si una estructura es objetivamente grande o pequeña. Un adagio común entre los genetistas clínicos es "no digas que es grande o pequeño sin medirlo primero", ya que una estructura puede parecer pequeña o grande, pero simplemente no guarda proporción con otras estructuras.

Los exámenes de tórax y abdomen deben incluir auscultación, ya que es posible que no se hayan observado antes algunos defectos cardíacos congénitos. (La auscultación cardíaca también es un momento en el que los pacientes jóvenes en la habitación se quedan quietos y silenciosos, y el examinador cuidadoso puede usar este tiempo para observar el rostro en silencio y con detenimiento).

Los exámenes genitourinarios también pueden revelar signos de hipogonadismo o incluso cambios dermatológicos como pecas en el glande como se ve en PTENTrastornos relacionados.

El examen de las extremidades y del sistema musculoesquelético puede revelar anomalías obvias, como pulgares ausentes o trifalángicos, o hallazgos más sutiles, como dedos anchos, clinodactilia o pliegues palmar asimétricos. La asimetría de las extremidades puede ser hemihiperplasia, lo que podría indicar un síndrome sistémico o mosaicismo tisular.

Un examen neurológico completo también es una herramienta importante para evaluar los déficits sutiles, aunque es importante conocer la línea de base previa del niño y qué déficits se pueden haber adquirido durante cualquier tratamiento o tratamiento del cáncer (como los cambios posquirúrgicos).


Polimorfismos del ADN: significado y clases | Genética

En este artículo discutiremos sobre el significado de una clase de polimorfismos de ADN.

Significado de los polimorfismos de ADN:

Diferentes alelos de un gen producen diferentes fenotipos que pueden detectarse haciendo cruces entre padres con diferentes alelos de dos o más genes. Luego, al determinar los recombinantes en la progenie, se puede deducir un mapa genético.

Estos son mapas genéticos de baja resolución que contienen genes con efectos fenotípicos observables, todos mapeados en sus respectivos loci. La posición de un gen o locus específico se puede encontrar en el mapa. Sin embargo, las mediciones mostraron que los intervalos cromosómicos entre los genes mapeados contendrían grandes cantidades de ADN.

Estos intervalos no pudieron mapearse mediante el método de la progenie recombinante porque no había marcadores en esas regiones intermedias. Se hizo necesario encontrar marcadores diferenciales adicionales o diferencias genéticas que caen en las brechas. Esta necesidad se cubrió mediante la explotación de varios marcadores de ADN polimórficos.

Un polimorfismo de ADN es una variación de la secuencia de ADN que no está asociada con ninguna variación fenotípica observable y puede existir en cualquier parte del genoma, no necesariamente en un gen. Polimorfismo significa una de dos o más formas alternativas (alelos) de una región cromosómica que tiene una secuencia de nucleótidos diferente o tiene un número variable de nucleótidos repetidos en tándem.

Por tanto, es un sitio de heterocigosidad para cualquier variación de secuencia. Muchos polimorfismos de ADN son útiles para estudios de mapeo genético, por lo que se denominan marcadores de ADN. Los marcadores de ADN pueden detectarse mediante hibridación por transferencia Southern o mediante PCR.

Los alelos de los marcadores de ADN son codominantes, es decir, no son ni dominantes ni recesivos como se observa en los alelos de la mayoría de los genes. Los polimorfismos de ADN constituyen diferencias definidas molecularmente entre seres humanos individuales.

Clases de polimorfismos de ADN:

Existen algunas clases importantes de polimorfismos de ADN.

1. Polimorfismos de un solo nucleótido:

SNP es un cambio de un solo par de bases, una mutación puntual, y el sitio se conoce como locus SNP. Los SNP son el tipo más común de polimorfismo de ADN, ocurren con una frecuencia de uno en 350 pares de bases y representan más del 90 por ciento de la variación de la secuencia de ADN. La mayoría de los SNP se encuentran presentes en las regiones no codificantes del genoma, conocidas como SNP no codificantes. Los SNP en las regiones codificantes, es decir, dentro de los genes, se conocen como SNP codificantes (cSNP).

Los estudios detallados de cSNP en humanos indican que cada gen tiene aproximadamente cuatro cSNP, la mitad de los cuales resultan en mutaciones sin sentido en la proteína codificada y la mitad de los cuales producen mutaciones silenciosas. Si un cSNP afecta un fenotipo, depende del aminoácido que cambia por el polimorfismo.

Se estima que aproximadamente la mitad de las mutaciones sin sentido que son SNP causan enfermedades genéticas en humanos. Un SNP no codificante también puede afectar la función del gen si está ubicado en la región promotora o en la región reguladora del gen. Un pequeño número de SNP puede crear un sitio de restricción o eliminar un sitio de restricción ya existente. Las alteraciones inducidas por SNP en los sitios de restricción se detectan usando la enzima de restricción seguida de análisis de transferencia Southern o PCR.

Se puede analizar un locus de SNP individual utilizando la técnica de hibridación de oligonucleótidos específicos de alelo (ASO). La búsqueda de un locus SNP particular en humanos es un desafío, porque este es un par de bases que es polimórfico de los tres mil millones de pares de bases en el genoma humano.

En la técnica ASO, se sintetiza un oligonucleótido corto que es complementario a un alelo SNP y se mezcla con el ADN diana. La hibridación se realiza en condiciones de alta rigurosidad que permitirían solo una coincidencia perfecta entre la sonda y el ADN diana. Eso significa que el oligonucleótido no se hibridará con el ADN diana que tenga cualquier otro alelo de SNP en ese locus. El resultado positivo de la hibridación indica el locus SNP con precisión.

Se puede utilizar una técnica más reciente de microarrays de ADN para la tipificación simultánea de cientos o miles de SNP. Los detalles de esta técnica utilizada para los SNP y la expresión génica de todo el genoma se describen más adelante en esta sección.

Una pequeña cantidad de SNP puede provocar cambios en los sitios de restricción, ya sea creando un sitio de restricción o eliminando uno. Dichos SNP se pueden detectar utilizando la enzima de restricción para el sitio, y la detección se realiza mediante análisis de transferencia Southern o PCR. Los diferentes patrones de sitios de restricción en diferentes genomas producen fragmentos de diferentes longitudes, llamados polimorfismos de longitud de fragmentos de restricción (RFLP) que se describen a continuación.

2. Polimorfismos de longitud de los fragmentos de restricción:

Los RFLP son sitios de reconocimiento de enzimas de restricción que están presentes en algunos genomas y ausentes en otros. Considere un organismo heterocigoto para un RFLP cuyo genotipo representamos como Rr. Este organismo se retrocruza con otro que es homocigoto para el alelo de variación RFLP (rr). El ADN genómico de la progenie de este cruzamiento (Rr x rr da una progenie de la cual el 50% es Rr y el 50% es rr) se somete a digestión con enzimas de restricción y los fragmentos se separan en transferencias Southern.

Los fragmentos de restricción obtenidos se hibridan con una sonda (un fragmento de ADN clonado) que distinguirá los distintos genotipos de un RFLP. El ADN de la sonda es único porque proviene de un solo segmento de ADN del genoma y se superpone al sitio de restricción. Un punto clave de esta técnica, por lo tanto, es el uso de una sonda de ADN de copia única clonada específica que es específica para un locus marcador individual.

Los cruces entre el organismo RFLP positivo con otros organismos portadores de RFLP producirían combinaciones y recombinaciones parentales. A partir de la frecuencia de los recombinantes, se puede producir un mapa RFLP detallado. Los RFLP fueron los primeros marcadores de ADN que se utilizaron para la caracterización de genomas de plantas y animales. Ahora han sido reemplazados por marcadores basados ​​en la variación en el número de repeticiones cortas en tándem (STR) que se describen a continuación.

3. Repeticiones cortas en tándem:

Los STR también se conocen como microsatélites y repeticiones de secuencia simple (SSR). Una repetición en tándem es una secuencia que se repite de un extremo a otro en la misma orientación. Los STR son secuencias de ADN de 2 a 6 pares de bases repetidas en tándem unas cuantas veces.

Por ejemplo, la secuencia TCACATCACATCACATCACATCACA es una repetición de cinco veces de la secuencia TCACA. Hay STR de dinucleótidos, trinucleótidos, cuatro nucleótidos, cinco nucleótidos y seis nucleótidos en el genoma humano.

El análisis de microsatélites se puede realizar utilizando un ADN de copia única que sirva como un par de cebadores de PCR específico para cada locus marcador. A diferencia de los RFLP que tienen solo uno o dos alelos en una población, los STR tienen un número mucho mayor de alelos que pueden detectarse en un análisis de población.

En consecuencia, los STR tienen una mayor proporción de heterocigotos, lo que los hace más adecuados para fines cartográficos. Los polimorfismos en los STR son comunes en las poblaciones, lo que los convierte en herramientas valiosas en el mapeo genético.

4. Número variable de repeticiones en tándem:

Los VNTR, también llamados marcadores de minisatélites, la unidad de repetición es un poco más grande que en los STR, de siete a unas pocas decenas de pares de bases de largo. Los loci VNTR en humanos son de 1 a 5 kilo-secuencias de bases que contienen unidades repetidas de aproximadamente 15 a 100 nucleótidos de longitud. Los loci VNTR también muestran polimorfismos. Debido a la mayor longitud de las repeticiones de VNTR que hace que la PCR no sea adecuada, el análisis de los VNTR se basa en la digestión por restricción y la transferencia Southern.

El ADN genómico completo se corta con una enzima de restricción que corta a ambos lados del locus VNTR, pero no tiene un sitio diana dentro de las matrices VNTR, seguido de transferencia Southern. La sonda específica de VNTR contra una secuencia repetida particular del locus VNTR se unirá en todas las ubicaciones de la secuencia repetida en el genoma, dando como resultado un gran número de fragmentos de diferentes tamaños.

El número de repeticiones en tándem es variable de un individuo a otro, por lo tanto, la transferencia Southern proporciona un patrón distintivo de fragmentos para un solo individuo. Estos patrones también se conocen como huellas dactilares de ADN. La técnica encuentra una aplicación útil en la identificación de individuos y en la decisión de paternidad.

5. Marcadores de microsatélites:

En el genoma se dispersan números variables de nucleótidos repetidos en tándem, llamados marcadores microsatélites. El tipo más común son CA y las repeticiones GT complementarias. Las sondas están diseñadas para la detección de regiones de ADN que rodean repeticiones de microsatélites individuales mediante PCR.

El procedimiento se explica tomando el ejemplo de ADN humano de la siguiente manera. El ADN genómico humano se somete a una digestión por restricción mediante una enzima como Alu l, que dará como resultado fragmentos de aproximadamente 400 pares de bases de longitud. Los fragmentos se clonan en un vector y se lleva a cabo una transferencia Southern.

Para identificar insertos genómicos que contienen di-nucleótidos CA / GT, se utilizan sondas específicas para estos di-nucleótidos. Se determina la secuencia de los clones positivos, sobre la base de la cual se diseñan cebadores de PCR que se hibridan con secuencias de ADN de copia única que flanquean las secuencias de microsatélites específicas repetidas en tándem. La amplificación por PCR se lleva a cabo utilizando estos pares de cebadores y ADN genómico.

Por lo tanto, si existe alguna variación de tamaño en el tramo de secuencia de microsatélites repetida en tándem, se detectaría mediante electroforesis en gel de los ADN de diferentes individuos. Las variaciones de tamaño pueden diferir entre los diferentes individuos, todas estas variaciones podrían determinarse.Una variación de tamaño da como resultado un producto de amplificación de un tamaño diferente y representa un alelo marcador.

6. ADN polimórfico amplificado aleatoriamente:

Los RAPD se basan en la amplificación por PCR aleatoria. El procedimiento se lleva a cabo diseñando aleatoriamente cebadores para PCR que amplificarán al azar varias regiones diferentes del genoma. Tal cebador da como resultado la amplificación de solo aquellas regiones de ADN que tienen cerca de ellas, copias invertidas de la propia secuencia del cebador.

Los productos de la PCR consisten en bandas de ADN que representan diferentes tamaños del ADN amplificado. El conjunto de fragmentos de ADN amplificados se denomina ADN polimórfico amplificado aleatoriamente (RAPD). Ciertas bandas pueden ser únicas para un individuo y pueden servir como marcadores de ADN en el análisis de mapas.


MATERIALES Y MÉTODOS

Cepas de levadura, plásmidos y anticuerpos

Las cepas de levadura se enumeran en la Tabla 1. pRS305-SIR2, un plásmido integrador que contiene sir2 impulsado por su promotor nativo, se utilizó. Mutante SIR2 también se clonaron genes en estos vectores.SIR2 y mutante sir2 Las cepas se generaron cortando pRS305-SIR2 dentro del LEU2 gen en unAflII e integrado usando protocolos estándar de transformación de levadura. SIR2 o mutante sir2clonado en el vector pET28a se utilizó para la producción de proteína recombinante. El marcado de hemaglutinina (HA) de SIR4se realizó con el vector pSF323-SIR4–3XHA (un regalo de Steve Bell), que integra una versión etiquetada de SIR4 en el nativo SIR4 lugar. Se han descrito previamente anticuerpos de conejo contra Sir2p y Sir3p (Mills et al., 1999 Imaiet al., 2000). El anticuerpo 12CA5 contra el epítopo HA se obtuvo de Covance y la histona H3 acetilada y la histona H4 acetilada se obtuvieron de Upstate Biotechnology (Lake Placid, NY).

Mutagénesis dirigida al sitio de SIR2

Los mutantes dirigidos al sitio se generaron en pRS305-SIR2 según Imaiet al. (2000) y subclonado en pET-28a (Imai et al., 2000). Las mutaciones se secuenciaron para asegurar que la mutagénesis fuera exitosa. La expresión de Sir2p en levadura se controló mediante análisis de transferencia Western de extractos de células completas sondeadas con anticuerpo anti-Sir2p.

Purificación de proteínas recombinantes y ensayos enzimáticos

Sir2p recombinante marcado con Six-his y Sir2p mutante se purificaron a partir de bacterias BL21 que sobreexpresaban el gen en un plásmido pET28a como se describió anteriormente (Imai et al., 2000). La ADP-ribosilación de histonas se detectó como se describió anteriormente (Imai et al., 2000). La actividad de desacetilación de histonas se midió usando un péptido correspondiente a la cola N-terminal de la histona H4 (SGRGKGGKGLGKGGAKRHRC) marcada con acetato tritiado usando el kit de ensayo de histona desacetilasa de Upstate Biotechnology. El ensayo se realizó incubando 2 µg de proteína recombinante con el péptido marcado en NAD + 1 mM durante la noche. A continuación, se utilizó acetato de etilo para separar los grupos acetilo liberados por la reacción de los que todavía estaban unidos al péptido. A continuación, se midió la actividad de desacetilación contando el acetato tritiado libre en un contador de centelleo. Los ensayos de desacetilación de histonas también se midieron realizando la reacción durante 1 hora y ejecutando los productos de reacción en una cromatografía líquida de alta resolución (HPLC) como se describió anteriormente (Imai et al., 2000).

Ensayos de silenciamiento y recombinación de ADNr

Para probar el silenciamiento en los telómeros, se colocaron diluciones de 10 veces los derivados de W303RT en medios que contenían ácido 5-fluoroorótico (5-FOA). Para ensayar el silenciamiento de HM, los derivados de W303R se colocaron en YPD con la cepa de prueba CKy20 y, después del crecimiento durante la noche, se sembraron en placas de réplica en un medio mínimo sin aminoácidos suplementados. Las tasas de recombinación de rDNA se midieron como en Kaeberlein et al.(1999).

Inmunoprecipitación de HA-Sir4 y Sir2

Se prepararon extractos de células completas a partir de células cultivadas en 100 ml de YPD hasta una DO de 1,0 (Strahl-Bolsinger et al., 1997). El extracto (200 µl) se diluyó hasta 500 µl con tampón de lisis al que se añadieron 3 µl de anticuerpo anti-HA y se incubó a 4 ° C durante la noche. A continuación, se añadieron perlas de proteína A y se incubaron adicionalmente a 4ºC durante 1 h. Las perlas se lavaron tres veces con tampón de lisis y luego se hirvieron en 60 µl de tampón de ejecución SDS. Se procesaron diez microlitros en un gel PAGE al 7,5% para el análisis de transferencia Western.

Inmunoprecipitación de cromatina

Se cultivaron levaduras en 100 ml de YPD hasta una DO de 1,0. La inmunoprecipitación del extracto reticulado se realizó esencialmente como se describe (Strahl-Bolsinger et al., 1997), utilizando 2,5 μl de anticuerpo policlonal anti-SIR3 o 5,0 μl de anticuerpo policlonal anti-SIR2, anti-histona H3 acetilada o anticuerpo anti-histona H4 acetilada. El análisis de la reacción en cadena de la polimerasa (PCR) del ADN inmunoprecipitado se realizó en volúmenes de reacción de 50 μl utilizando 1:25, 1:75 y 1: 225 del ADN inmunoprecipitado total. Las condiciones de reacción de PCR fueron las descritas utilizando los siguientes cebadores: TEL-300.fwd, GGATATGTCAAAATTGGATACGCTTATG TEL-300.rev, CTATAGTTGATTATAGATCCTCAATGATC TEL-3000.fwd, TGATTCTGCTTTATCTACTTGCGTTTC TEL-3000.rev. .rev, AAATGAA-ATGTATTGGGGCCTAGGTTCGCA. El análisis de transferencia de ranura se realizó transfiriendo 10 µl de ADN inmunoprecipitado (IP) o 5 µl de ADN de entrada a una membrana Zeta-Probe utilizando un aparato de transferencia de ranura Bio-Rad. A continuación, la transferencia se probó con un fragmento de ADN marcado con 32P correspondiente a la secuencia de ADNr de 5S.


Selección dependiente de la frecuencia

Figura 2. Un lagarto de garganta amarilla y manchas laterales es más pequeño que los machos de garganta azul o naranja y se parece un poco a las hembras de la especie, lo que le permite copular furtivamente. (crédito: "tinyfroglet" / Flickr)

Otro tipo de selección, llamado selección dependiente de la frecuencia, favorece los fenotipos que son comunes (selección dependiente de la frecuencia positiva) o raros (selección dependiente de la frecuencia negativa). Un ejemplo interesante de este tipo de selección se ve en un grupo único de lagartos del noroeste del Pacífico. Los machos de lagartijas comunes con manchas laterales vienen en tres patrones de color de garganta: naranja, azul y amarillo. Cada una de estas formas tiene una estrategia reproductiva diferente: los machos naranjas son los más fuertes y pueden pelear con otros machos para acceder a sus hembras, los machos azules son de tamaño mediano y forman fuertes lazos de pareja con sus parejas y los machos amarillos (Figura 2) son los más pequeños. y parecerse un poco a las hembras, lo que les permite copular a escondidas. Como un juego de piedra-papel-tijera, el naranja vence al azul, el azul vence al amarillo y el amarillo vence al naranja en la competencia por las mujeres. Es decir, los machos naranjas grandes y fuertes pueden luchar contra los machos azules para aparearse con las hembras azules y # 8217s emparejadas, los machos azules tienen éxito en proteger a sus parejas contra los machos de zapatillas amarillas, y los machos amarillos pueden escabullirse de las copulaciones de los machos. parejas potenciales de los grandes machos anaranjados poliginosos.

En este escenario, los machos naranjas se verán favorecidos por la selección natural cuando la población esté dominada por machos azules, los machos azules prosperarán cuando la población sea principalmente de machos amarillos y los machos amarillos se seleccionarán para cuando los machos naranjas sean los más poblados. Como resultado, las poblaciones de lagartijas de manchas laterales tienen un ciclo en la distribución de estos fenotipos; en una generación, el naranja puede ser predominante y luego los machos amarillos comenzarán a aumentar en frecuencia. Una vez que los machos amarillos constituyan la mayoría de la población, se seleccionarán los machos azules. Finalmente, cuando los machos azules se vuelvan comunes, los machos anaranjados volverán a ser los favoritos.

La selección dependiente de la frecuencia negativa sirve para aumentar la varianza genética de la población seleccionando fenotipos raros, mientras que la selección dependiente de la frecuencia positiva normalmente disminuye la varianza genética seleccionando fenotipos comunes.


5. Alimentación de ARNi en placas de agar

Julie Ahringer, The Gurdon Institute, Universidad de Cambridge, Cambridge CB2 1QN, Reino Unido

Sinopsis: Cultive bacterias ARNi y placas de semillas. Alimente a los gusanos con bacterias ARNi y califique los fenotipos. Lo siguiente se basa en el protocolo de Kamath et al. (2001).

5.1. Preparación de platos de alimentación

Vierta las placas: prepare agar NGM estándar y agregue carbenicilina a 25 & # 956g / ml e IPTG a 1 mM justo antes de verter. Vierta los platos 4 & # 82117 días antes de la siembra, para permitir que se sequen. Si las placas están demasiado húmedas, las bacterias no se secarán después de la siembra y los fenotipos de ARNi serán más débiles. La alimentación se puede realizar utilizando placas de cualquier formato (por ejemplo, placas individuales, 6 pocillos, 12 pocillos).

Coloque la (s) cepa (s) bacteriana (s) individual (es) deseada (s) de la reserva de glicerol en una placa LB que contenga 50 & # 956 g / ml de ampicilina (o 25 & # 956 g / ml de carbenicilina) y 10 & # 956 g / ml de tetraciclina. Use un replicador de 96 pines para colocar en una placa plana rectangular si está cultivando en formato de 96 pocillos. Crezca durante la noche a 37 ° C.

Haga crecer los cultivos en medio LB que contenga 50 & # 956 g / ml de ampicilina. Si utiliza un formato de 96 pocillos, agregue 800 & # 956l de medio a cada pocillo de una placa de 96 pocillos profundos. Para inocular los cultivos, utilice puntas amarillas individuales o puntas en una pipeta multicanal para raspar las bacterias de una fila o columna y expulsar las puntas a la fila o columna correcta de medio. Cuando termine de inocular, retire las puntas y cubra las placas con tapas plásticas de microtitulación. Cultive los cultivos con agitación a 300 rpm durante 6 & # 82118 horas.

Semilla de agar NGM que alimenta las placas del cultivo bacteriano. Use dos gotas de 30 & # 956l si usa placas de 12 pocillos, y tres gotas de 50 & # 956l si usa placas de 6 pocillos o individuales. Deje secar e inducir durante la noche a temperatura ambiente.

5.2. Preparando los gusanos

Cultive la cepa de gusano deseada en placas NGM estándar sembradas con bacterias OP50. Llevar a cabo el protocolo estándar de blanqueo / lavado para obtener embriones y dejar incubar en L1 durante la noche en tampón M9. Estos L1 hambrientos se sincronizarán al comienzo de la etapa L1. Si la alimentación se realizará con larvas mayores de L1, coloque las L1 eclosionadas en placas NGM estándar que contengan OP50 y crezcan hasta la etapa deseada.

Lave los gusanos de las placas con tampón M9, luego lave 3 veces para eliminar las bacterias. Es fundamental eliminar OP50 ya que las bacterias residuales que no son ARNi interferirán con los resultados de la alimentación. Resuspenda el sedimento de gusano final en tampón M9 que contenga Tween-20 al 0,1% para evitar que se pegue al plástico. Ajuste el volumen de la solución tampón de modo que el número de gusanos que desee dividir en alícuotas por placa sea de 10 & # 821115 & # 956l.

5.3. Alimentación y puntuación

Esta parte del protocolo diferirá ligeramente según su ensayo. Después de la alimentación, se pueden puntuar los gusanos en alícuotas o su progenie. Para algunos ensayos, la puntuación es más fácil si la progenie está sincronizada. En este caso, a las madres embarazadas alimentadas se les permite poner huevos en un plato nuevo, luego se retiran y posteriormente se puntúa la progenie. Este paso lleva mucho tiempo y no siempre es necesario.

5.3.1. Protocolo de alimentación estándar L3 / L4: puntuación de la progenie sincronizada

En este protocolo, se puntúa una población de progenie semisincronizada colocada en una ventana de 24 horas.

Alícuota de 10 y # 821115 y # 956l de gusanos L3 / L4 por placa o pocillo (10 y # 821120 gusanos).

Deje 72 horas a 15 ° C (o 36 ° # 821140 horas a 22 ° C) para que el ARNi surta efecto, luego reproduzca la placa de adultos individuales en otras placas o pocillos sembrados con la misma bacteria.

Después de 24 horas, retire a los adultos de la réplica y puntúe la progenie en cuanto a fenotipos en los puntos de tiempo apropiados.

5.3.2. Protocolo de alimentación optimizado L3 / L4: puntuación de la progenie asincrónica

En este protocolo, se puntúa toda la progenie puesta por madres alimentadas. Tiene la ventaja de ser rápido, ya que no requiere un recubrimiento de réplica. La progenie sembrada al principio y al final del protocolo de alimentación se encuentra en un solo pozo, produciendo una variedad de caídas de ARNi, de débil a fuerte. Esto puede ser útil si se realizan pruebas de detección de fenotipos post-embrionarios, donde una caída fuerte podría causar letalidad embrionaria. La letalidad embrionaria de bajo porcentaje es difícil de puntuar con este método.

Alícuota 10 & # 821115 & # 956l de gusanos L3 / L4 por placa o pocillo. Como los adultos y toda la progenie permanecerán en este plato o pozo inicial, es importante no tener demasiados gusanos para la comida disponible. El número óptimo debe determinarse empíricamente. Para placas de 6 pocillos, el uso de 10 gusanos por pocillo debería permitir la puntuación de la progenie adulta en la mayoría de los casos.

Puntúe cuando la progenie alcance la edad deseada.

5.3.3. Alimentación de L1 en lugar de L4

Se pueden usar L1 en lugar de L4 en cualquiera de los protocolos anteriores. Una ventaja de usar L1s es que algunos fenotipos pueden puntuarse en los gusanos alimentados en lugar de en la progenie, lo que permite utilizar una población sincronizada fácilmente puntuada. Sin embargo, para algunos genes, el producto materno heredado será suficiente para la actividad genética, evitando la inducción de un fenotipo en los gusanos alimentados. Además, como se requieren muchos genes en múltiples momentos del desarrollo, se pueden observar diferentes fenotipos cuando se usan L1 en comparación con L4. Por ejemplo, el ARNi de algunos genes induce la esterilidad de los L1 alimentados, mientras que la alimentación con L4 induce la letalidad embrionaria de la progenie. Esto impedirá la puntuación de la progenie de estos genes si se alimentan con L1. Por el contrario, el uso de L1 es beneficioso si el ensayo es para cualquier forma de letalidad (p. Ej., Esterilidad, letalidad larvaria o letalidad embrionaria).

Notas: No se recomienda dividir los embriones blanqueados en alícuotas directamente en los platos de alimentación en lugar de incubarlos en L1 hambrientos primero porque es más difícil hacer alícuotas del mismo número de animales / pocillo debido a que los embriones se pegan entre sí. Además, las tasas de eclosión variables entre preparaciones blanqueadas causarán variación entre experimentos.

5.4. Alimentando dos cepas bacterianas al mismo tiempo

El protocolo es idéntico a la alimentación de una única cepa bacteriana, excepto que los dos cultivos bacterianos se mezclan antes de la siembra. La doble alimentación funciona mucho mejor y de forma más reproducible en una cepa supersensible al ARNi (p. Ej., rrf-3 Simmer et al., 2002 eri-1 Kennedy et al., 2004 o eri-1 lin-15B Wang et al., 2005 S. Woods, D. Rivers y J. Ahringer, A. Fraser inédito, com. Pers. com.). En una prueba de 17 alimentaciones dobles de control, 4 tuvieron éxito en eri-1 , 7 en rrf-3 , y 14 en eri-1 lin-15B (S. Woods, D. Rivers y J. Ahringer, inédito). La alimentación doble es menos confiable que la alimentación única, por lo que en algunos casos, solo un gen puede estar significativamente inhibido, o ambos genes pueden estar ligeramente derribados. Deben realizarse controles para probar la desactivación de cada gen.

5.5. Agradecimientos

Agradezco a los miembros del laboratorio sus comentarios. Esta es una modificación del protocolo desarrollado por Ravi Kamath (Kamath et al., 2001), con modificaciones de Gino Poulin, David Rivers y Shane Woods.


Notas al pie

† Dirección actual: Departamento de Ciencias Biológicas, Universidad Xi'an Jiaotong-Liverpool, 111 Ren'ai Road, Suzhou 215123, República Popular de China

El material complementario electrónico está disponible en línea en https://doi.org/10.6084/m9.figshare.c.4933104.

Publicado por la Royal Society bajo los términos de la licencia de atribución Creative Commons http://creativecommons.org/licenses/by/4.0/, que permite el uso sin restricciones, siempre que se acredite el autor y la fuente originales.

Referencias

. 2011 ¿Por qué no tenemos más cáncer? Un papel propuesto del microambiente en la restricción de la progresión del cáncer. Nat. Medicina. 17, 320-329. (doi: 10.1038 / nm.2328) Crossref, PubMed, ISI, Google Académico

Fridman WH, Zitvogel L, Sautes-Fridman C, Kroemer G

. 2017 La contextura inmune en el pronóstico y el tratamiento del cáncer. Nat. Rev. Clin. Oncol. 14, 717. (doi: 10.1038 / nrclinonc.2017.101) Crossref, PubMed, ISI, Google Scholar

Vermeulen L, Morrissey E, van der Heijden M, Nicholson AM, Sottoriva A, Buczacki S, Kemp R, Tavaré S, Winton DJ

. 2013 Definición de la dinámica de las células madre en modelos de iniciación de tumores intestinales. Ciencias 342, 995-998. (doi: 10.1126 / science.1243148) Crossref, PubMed, ISI, Google Académico

. 1889 La distribución de crecimientos secundarios en cáncer de mama. Lanceta 133, 571-573. (doi: 10.1016 / S0140-6736 (00) 49915-0) Crossref, Google Académico

. 1976 La evolución clonal de poblaciones de células tumorales. Ciencias 194, 23-28. (doi: 10.1126 / science.959840) Crossref, PubMed, ISI, Google Académico

. 1993 Mutaciones, teoría evolutiva y cáncer. Tendencias Ecol. Evol. 8, 107-110. (doi: 10.1016 / 0169-5347 (93) 90062-T) Crossref, PubMed, ISI, Google Académico

. 2001 El microambiente de la interfaz tumor-huésped. Naturaleza 411, 375-379. (doi: 10.1038 / 35077241) Crossref, PubMed, ISI, Google Académico

Merlo LM, Pepper JW, Reid BJ, Maley CC

. 2006 El cáncer como proceso evolutivo y ecológico. Nat. Rev.Cáncer 6, 924-935. (doi: 10.1038 / nrc2013) Crossref, PubMed, ISI, Google Académico

Korolev KS, Xavier JB, Gore J

. 2014 Volviendo ecología y evolución contra el cáncer. Nat. Rev.Cáncer 14, 371-380. (doi: 10.1038 / nrc3712) Crossref, PubMed, ISI, Google Académico

. 2005 Biología evolutiva del cáncer. Tendencias Ecol. Evol. 20, 545-552. (doi: 10.1016 / j.tree.2005.07.007) Crossref, PubMed, ISI, Google Académico

. 1993 La naturaleza de varios pasos del cáncer. Trends Genet. 9, 138-141. (doi: 10.1016 / 0168-9525 (93) 90209-Z) Crossref, PubMed, ISI, Google Académico

. 2005 La teoría genética de la adaptación: una breve historia. Nat. Rev. Genet. 6, 119-127. (doi: 10.1038 / nrg1523) Crossref, PubMed, ISI, Google Académico

. 2008 Un modelo microambiental de carcinogénesis. Nat. Rev.Cáncer 8, 56-61. (doi: 10.1038 / nrc2255) Crossref, PubMed, ISI, Google Académico

Junttila MR, de Sauvage FJ

. 2013 Influencia de la heterogeneidad del microambiente tumoral en la respuesta terapéutica. Naturaleza 501, 346-354. (doi: 10.1038 / nature12626) Crossref, PubMed, ISI, Google Académico

. 2013 Regulación microambiental de la progresión tumoral y metástasis. Nat. Medicina. 19, 1423-1437. (doi: 10.1038 / nm.3394) Crossref, PubMed, ISI, Google Académico

. 2016 Orientación al microambiente en el cáncer colorrectal avanzado. Tendencias del cáncer 2, 495-504. (doi: 10.1016 / j.trecan.2016.08.001) Crossref, PubMed, ISI, Google Académico

2017 Microambientes heterogéneos inmunes a tumores entre metástasis de crecimiento diferencial en una paciente con cáncer de ovario. Celda 170, 927-938.e20. (doi: 10.1016 / j.cell.2017.07.025) Crossref, PubMed, ISI, Google Académico

2018 Interfaces de dinámicas clonales malignas e inmunológicas en el cáncer de ovario. Celda 173, 1755-1769.e22.(doi: 10.1016 / j.cell.2018.03.073) Crossref, PubMed, ISI, Google Académico

. 2011 Distintivos del cáncer: la próxima generación. Celda 144, 646-674. (doi: 10.1016 / j.cell.2011.02.013) Crossref, PubMed, ISI, Google Académico

Lan C, Heindl A, Huang X, Xi S, Banerjee S, Liu J, Yuan Y

. 2015 Análisis histológico cuantitativo del microambiente tumoral de ovario. Sci. Reps. 5, 16317. (doi: 10.1038 / srep16317) Crossref, PubMed, ISI, Google Scholar

2015 La pérdida de PTEN inducida por microambiente por microARN exosómico prepara el crecimiento de metástasis cerebral. Naturaleza 527, 100-104. (doi: 10.1038 / nature15376) Crossref, PubMed, ISI, Google Académico

La leucemia aguda de células T de 2016 exhibe interacciones dinámicas con microambientes de la médula ósea. Naturaleza 538, 518-522. (doi: 10.1038 / nature19801) Crossref, PubMed, ISI, Google Académico

. 2016 Características e importancia del nicho premetastásico. Célula cancerosa 30, 668-681. (doi: 10.1016 / j.ccell.2016.09.011) Crossref, PubMed, ISI, Google Académico

Dewhirst MW, Cao Y, Moeller B

. 2008 La hipoxia cíclica y los radicales libres regulan la respuesta a la angiogénesis y la radioterapia. Nat. Rev.Cáncer 8, 425-437. (doi: 10.1038 / nrc2397) Crossref, PubMed, ISI, Google Académico

. 2016 Control hipóxico de metástasis. Ciencias 352, 175-180. (doi: 10.1126 / science.aaf4405) Crossref, PubMed, ISI, Google Académico

Altrock PM, Liu LL, Michor F

. 2015 Las matemáticas del cáncer: integración de modelos cuantitativos. Nat. Rev.Cáncer 15, 730-745. (doi: 10.1038 / nrc4029) Crossref, PubMed, ISI, Google Académico

. 1997 Modelado de las consecuencias de las interacciones entre células tumorales. Br. J. Cáncer 75, 157-160. (doi: 10.1038 / bjc.1997.26) Crossref, PubMed, ISI, Google Académico

Waclaw B, Bozic I, Pittman ME, Hruban RH, Vogelstein B, Nowak MA

. 2015 Un modelo espacial predice que la dispersión y el recambio celular limitan la heterogeneidad intratumoral. Naturaleza 525, 261-264. (doi: 10.1038 / nature14971) Crossref, PubMed, ISI, Google Académico

2015 Un modelo Big Bang de crecimiento de tumores colorrectales humanos. Nat. Gineta. 47, 209-216. (doi: 10.1038 / ng.3214) Crossref, PubMed, ISI, Google Académico

Anderson AR, Weaver AM, Cummings PT, Quaranta V

. 2006 Morfología tumoral y evolución fenotípica impulsada por la presión selectiva del microambiente. Celda 127, 905-915. (doi: 10.1016 / j.cell.2006.09.042) Crossref, PubMed, ISI, Google Académico

Lloyd MC, Cunningham JJ, Bui MM, Gillies RJ, Brown JS, Gatenby RA

. 2016 Dinámica darwiniana de la heterogeneidad intratumoral: no solo mutaciones aleatorias sino también fuerzas de selección ambiental variables. Cancer Res. 76, 3136-3144. (doi: 10.1158 / 0008-5472.CAN-15-2962) Crossref, PubMed, ISI, Google Académico

. 1930 La teoría genética de la selección natural . Oxford, Reino Unido: The Clarendon Press. Crossref, académico de Google

. 2005 Microscopio de Fisher y elipse de Haldane. Soy. Nat. 166, 447-457. (doi: 10.1086 / 444404) Crossref, PubMed, ISI, Google Académico

2015 La expresión de GREM1 epitelial aberrante inicia la tumorigénesis colónica a partir de células fuera del nicho de células madre. Nat. Medicina. 21, 62-70. (doi: 10.1038 / nm.3750) Crossref, PubMed, ISI, Google Académico

Castro-Giner F, Ratcliffe P, Tomlinson I

. 2015 El modelo de mini-conductor de la evolución del cáncer poligénico. Nat. Rev.Cáncer 15, 680-685. (doi: 10.1038 / nrc3999) Crossref, PubMed, ISI, Google Académico

Barnett GC, West CM, Dunning AM, Elliott RM, Coles CE, Pharoah PD, Burnet NG

. 2009 Reacciones tisulares normales a la radioterapia: hacia la adaptación de la dosis de tratamiento por genotipo. Nat. Rev.Cáncer 9134-142. (doi: 10.1038 / nrc2587) Crossref, PubMed, ISI, Google Académico

Temko D, Tomlinson IPM, Severini S, Schuster-Bockler B, Graham TA

. 2018 Los efectos de los procesos mutacionales y la selección en las mutaciones impulsoras en todos los tipos de cáncer. Nat. Comun. 9, 1857. (doi: 10.1038 / s41467-018-04208-6) Crossref, PubMed, ISI, Google Scholar

. 2013 Cómo influyen los procesos de envejecimiento en el cáncer. Nat. Rev.Cáncer 13, 357-365. (doi: 10.1038 / nrc3497) Crossref, PubMed, ISI, Google Académico

Reeves MQ, Kandyba E, Harris S, Del Rosario R, Balmain A

. 2018 El rastreo de linaje multicolor revela la dinámica clonal de la evolución del carcinoma escamoso desde el inicio hasta la metástasis. Nat. Cell Biol. 20, 699-709. (doi: 10.1038 / s41556-018-0109-0) Crossref, PubMed, ISI, Google Académico

. 2019 Comportamiento crítico de las redes espaciales como modelo de señalización paracrina en tumorigénesis. Apl. Netw. Sci. 4, 47. (doi: 10.1007 / s41109-019-0167-7) Crossref, Google Académico

. 2001 Condensación de Bose-Einstein en redes complejas. Phys. Rev. Lett. 86, 5632-5635. (doi: 10.1103 / PhysRevLett.86.5632) Crossref, PubMed, ISI, Google Académico

. 1963 Análisis del ciclo de vida en células de mamíferos. Naturaleza 198, 359-361. (doi: 10.1038 / 198359a0) Crossref, ISI, Google Académico

. 2019 Relojes circadianos y cáncer: el cronometraje gobierna el metabolismo celular. Tendencias Endocrinol. Metab. 30, 445-458. (doi: 10.1016 / j.tem.2019.05.001) Crossref, PubMed, ISI, Google Académico

. 2019 Interacción entre el reloj circadiano y el cáncer: nuevas fronteras para el tratamiento del cáncer. Tendencias del cáncer 5, 475-494. (doi: 10.1016 / j.trecan.2019.07.002) Crossref, PubMed, ISI, Google Académico

Gatenby RA, Silva AS, Gillies RJ, Frieden BR

. 2004 La base anti-angiogénica de la quimioterapia metronómica. Nat. Rev.Cáncer 4, 423-436. (doi: 10.1038 / nrc1369) Crossref, PubMed, ISI, Google Académico

Zhang J, Cunningham JJ, Brown JS, Gatenby RA

. 2017 Integración de la dinámica evolutiva en el tratamiento del cáncer de próstata metastásico resistente a la castración. Nat. Comun. 8, 1816. (doi: 10.1038 / s41467-017-01968-5) Crossref, PubMed, ISI, Google Scholar

. 2005 Orientación terapéutica del microambiente tumoral. Célula cancerosa 7, 513-520. (doi: 10.1016 / j.ccr.2005.05.024) Crossref, PubMed, ISI, Google Académico

Pich O, Muinos F, Lolkema MP, Steeghs N, Gonzalez-Perez A, Lopez-Bigas N

. 2019 Las huellas mutacionales de las terapias contra el cáncer. Nat. Gineta. 51, 1732-1740. (doi: 10.1038 / s41588-019-0525-5) Crossref, PubMed, ISI, Google Académico

Williams MJ, Werner B, Heide T, Curtis C, Barnes CP, Sottoriva A, Graham TA

. 2018 Cuantificación de la selección subclonal en cáncer a partir de datos de secuenciación masiva. Nat. Gineta. 50, 895-903. (doi: 10.1038 / s41588-018-0128-6) Crossref, PubMed, ISI, Google Académico

. 2012 Evolución de rasgos fenotípicos adaptativos sin selección darwiniana positiva. Herencia 108, 347-353. (doi: 10.1038 / hdy.2011.97) Crossref, PubMed, ISI, Google Académico

. 1932 Los roles de la mutación, la consanguinidad, el cruzamiento y la selección en la evolución. Proc. Sexta Int. Congr. Gineta. 1, 356-366. Google Académico

. 1932 Las causas de la evolución , Nueva York, NY: Longmans, Green and Co. Google Académico

. 2006 Una extensión general multivariante del modelo geométrico de Fisher y la distribución de los efectos de la aptitud de las mutaciones entre las especies. Evolución 60, 893-907. (doi: 10.1111 / j.0014-3820.2006.tb01169.x) Crossref, PubMed, ISI, Google Académico

Matuszewski S, Hermisson J, Kopp M

. Modelo geométrico de Fisher 2014 con un óptimo en movimiento. Evolución. 68, 2571-2588. (doi: 10.1111 / evo.12465) Crossref, PubMed, ISI, Google Académico

. 2014 La utilidad del modelo geométrico de Fisher en genética evolutiva. Annu. Rev. Ecol. Evol. Syst. 45, 179-201. (doi: 10.1146 / annurev-ecolsys-120213-091846) Crossref, PubMed, ISI, Google Académico

Fraisse C, Gunnarsson PA, Roze D, Bierne N, Welch JJ

. 2016 La genética de la especiación: conocimientos del modelo geométrico de Fisher. Evolución 70, 1450-1464. (doi: 10.1111 / evo.12968) Crossref, PubMed, ISI, Google Académico

Lourenco JM, Glemin S, Galtier N

. 2013 La tasa de adaptación molecular en un entorno cambiante. Mol. Biol. Evol. 30, 1292-1301. (doi: 10.1093 / molbev / mst026) Crossref, PubMed, ISI, Google Académico

Razeto-Barry P, Díaz J, Vasquez RA

. 2012 Las teorías casi neutrales y de selección de la evolución molecular bajo el marco geométrico de Fisher: tasa de sustitución, tamaño de la población y complejidad. Genética 191, 523-534. (doi: 10.1534 / genetics.112.138628) Crossref, PubMed, ISI, Google Académico

Blanquart F, Achaz G, Bataillon T, Tenaillon O

. 2014 Propiedades de mutaciones seleccionadas y paisajes genotípicos bajo el modelo geométrico de Fisher. Evolución 68, 3537-3554. (doi: 10.1111 / evo.12545) Crossref, PubMed, ISI, Google Académico

. 1999 Selección, la tasa de mutación y el cáncer: asegurarse de que la cola no mueva al perro. Nat. Medicina. 5, 11-12. (doi: 10.1038 / 4687) Crossref, PubMed, ISI, Google Académico

. 1999 Sexo y adaptación en un entorno cambiante. Genética 153, 1041-1053. PubMed, ISI, Google Académico

. 2009 La base genética de la adaptación fenotípica II: la distribución de sustituciones adaptativas en el modelo óptimo móvil. Genética 183, 1453-1476. (doi: 10.1534 / genetics.109.106195) Crossref, PubMed, ISI, Google Académico

. 2012 Modelo geométrico de Fisher del panorama de la aptitud y la variación en la aptitud en un entorno cambiante. Evolución 66, 2350-2368. (doi: 10.1111 / j.1558-5646.2012.01610.x) Crossref, PubMed, ISI, Google Académico

. 2006 Modelo geométrico de Fisher de adaptación evolutiva: más allá de la geometría esférica. J Theor. Biol. 241, 887-895. (doi: 10.1016 / j.jtbi.2006.01.024) Crossref, PubMed, ISI, Google Académico

Sottoriva A, Spiteri I, Shibata D, Curtis C, Tavare S

. 2013 Los datos genómicos de una sola molécula delinean los perfiles tumorales específicos del paciente y la organización de las células madre del cáncer. Cancer Res. 73, 41-49. (doi: 10.1158 / 0008-5472.CAN-12-2273) Crossref, PubMed, ISI, Google Académico

Jones AG, Arnold SJ, Burger R

. 2004 Evolución y estabilidad de la matriz G en un paisaje con óptimo en movimiento. Evolución 58, 1639-1654. (doi: 10.1111 / j.0014-3820.2004.tb00450.x) Crossref, PubMed, ISI, Google Académico

. 1993 La selección direccional y la evolución del sexo y la recombinación. Gineta. Res. 61205-224. (doi: 10.1017 / S0016672300031372) Crossref, PubMed, ISI, Google Académico

Elena SF, Cooper VS, Lenski RE

. 1996 Evolución puntuada causada por la selección de mutaciones beneficiosas raras. Ciencias 272, 1802-1804. (doi: 10.1126 / science.272.5269.1802) Crossref, PubMed, ISI, Google Académico

2009 La hipersensibilidad a la inhibición por contacto proporciona una pista de la resistencia al cáncer de la rata topo desnuda. Proc. Natl Acad. Sci. Estados Unidos 106, 19352-19 357. (doi: 10.1073 / pnas.0905252106) Crossref, ISI, Google Scholar

Sulak M, Fong L, Mika K, Chigurupati S, Yon L, Mongan NP, Emes RD, Lynch VJ

. La expansión del número de copias de TP53 de 2016 se asocia con la evolución de un mayor tamaño corporal y una respuesta mejorada al daño del ADN en los elefantes. eLife 5, e11994. (doi: 10.7554 / eLife.11994) Crossref, PubMed, ISI, Google Académico

2010 Acumulación de mutaciones del conductor y del pasajero durante la progresión del tumor. Proc. Natl Acad. Sci. Estados Unidos 107, 18 545-18 550. (doi: 10.1073 / pnas.1010978107) Crossref, ISI, Google Scholar

. 2009 La base genética de la adaptación fenotípica I: fijación de mutaciones beneficiosas en el modelo óptimo móvil. Genética 182, 233-249. (doi: 10.1534 / genetics.108.099820) Crossref, PubMed, ISI, Google Académico

. 2015 El efecto de aptitud de las mutaciones en distintos entornos: modelo geométrico de Fisher con múltiples óptimos. Evolución 69, 1433-1447. (doi: 10.1111 / evo.12671) Crossref, PubMed, ISI, Google Académico

2004 Unificando la dinámica epidemiológica y evolutiva de patógenos. Ciencias 303, 327-332. (doi: 10.1126 / science.1090727) Crossref, PubMed, ISI, Google Académico

. 2005 Sobre pruebas estadísticas de desequilibrio de árboles filogenéticos: revisión de los índices de Sackin y otros. Matemáticas. Biosci. 195141-153. (doi: 10.1016 / j.mbs.2005.03.003) Crossref, PubMed, ISI, Google Académico

. 2015 Midiendo la asimetría en filogenias con marca de tiempo. PLoS Comput. Biol. 11, e1004312. (doi: 10.1371 / journal.pcbi.1004312) Crossref, PubMed, ISI, Google Académico

Martin G, Elena SF, Lenormand T

. 2007 Las distribuciones de epistasis en microbios se ajustan a las predicciones de un modelo de paisaje de aptitud. Nat. Gineta. 39, 555-560. (doi: 10.1038 / ng1998) Crossref, PubMed, ISI, Google Académico

. 2010 Ponencias del coloquio: paisajes adaptativos y evolución de proteínas. Proc. Natl Acad. Sci. Estados Unidos 107(Supl. 1), 1747-1751. (doi: 10.1073 / pnas.0906192106) Crossref, PubMed, ISI, Google Académico

Szendro IG, Schenk MF, Franke J, Krug J, de Visser JAGM

. 2013 Análisis cuantitativos de paisajes de aptitud empíricos. J. Stat. Mech .: Teoría Exp. 2013, P01005. (doi: 10.1088 / 1742-5468 / 2013/01 / P01005) Crossref, ISI, Google Académico


Ver el vídeo: Mutaciones Génicas. Procesos que las generan Parte 2 (Agosto 2022).