Información

¿Puede una celda recibir múltiples copias de un inserto cuando se utilizan diferentes MOI?

¿Puede una celda recibir múltiples copias de un inserto cuando se utilizan diferentes MOI?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Quiero transducir una línea celular con un virus que lleve un inserto específico.

Cuando utilizo una multiplicidad de infección (MOI) diferente, espero obtener un porcentaje diferente de células transducidas, pero ¿es posible obtener más de un inserto integrado en el genoma celular? Utilizo un MOI alto y siempre obtengo 1 copia por celda, por lo que no estoy seguro de si aumentarlo mucho también puede afectar el número de inserciones integradas.


Sí, si usa un MOI lo suficientemente alto, comenzará a tener infecciones dobles. Por lo general, cualquier valor> 1 MOI garantizará una alta probabilidad de infecciones dobles. Si está usando un MOI alto y solo ve inserciones individuales, puede deberse a que sus células son difíciles de transfectar. Si miras este sitio: https://manuals.cellecta.com/lentiviral-construct-packaging-and-transduction/v10a/en/topic/lentiviral-titer-calculation, debería darte una referencia general del% de transfección doble celdas que debería ver. La diferencia entre las células transfectadas y el% de MOI debería estimar infecciones dobles asumiendo una eficacia del 100%.

Algunas células son menos eficientes para ser transfectadas, y es una buena idea obtener un título funcional en su línea celular objetivo, lo cual es muy fácil si tiene un fluoróforo en el plásmido que está tratando de insertar.

Vuelvo a leer a lo que te refieres y, en general, se acepta que un MOI inferior a 0,4 no te dará transfecciones dobles.


Un enfoque versátil basado en CRISPR-Cas9 de un solo paso para el curado de plásmidos

Los plásmidos son herramientas esenciales y ampliamente utilizadas en biología molecular. Sin embargo, los plásmidos a menudo imponen una carga metabólica y solo son útiles temporalmente para fines de ingeniería genética, biodetección y caracterización. Si bien existen numerosas técnicas para la manipulación genética, falta una herramienta universal que permita la eliminación rápida de plásmidos de las células bacterianas.

Resultados

Basándonos en la abundancia de replicones y el análisis de conservación de secuencias, mostramos que la gran mayoría de los vectores de expresión y clonación bacteriana comparten similitudes de secuencia que permiten una amplia orientación a CRISPR-Cas9. Hemos construido un sistema universal de curado de plásmidos (pFREE) y desarrollado un protocolo de un solo paso y un procedimiento de PCR que permiten la identificación de clones sin plásmidos en 24 h. Si bien el contexto de los replicones específicos afecta la eficiencia, obtuvimos eficiencias de curado entre el 40 y el 100% para los plásmidos más utilizados con fines de expresión e ingeniería. En virtud de la orientación CRISPR-Cas9, nuestra plataforma es altamente expandible y se puede aplicar en un contexto de host amplio. Ejemplificamos la amplia aplicabilidad de nuestro sistema en bacterias Gram-negativas al demostrar la aplicación exitosa en ambos Escherichia coli y el prometedor chasis de fábrica de células Pseudomonas putida.

Conclusión

Como sistema de curado de plásmidos rápido y de libre acceso, dirigido a prácticamente todos los vectores utilizados con fines de clonación y expresión, creemos que pFREE tiene el potencial de eliminar la necesidad de soluciones suicidas de vectores individualizadas en biología molecular. Prevemos que la aplicación de pFREE sea especialmente útil en metodologías que involucran múltiples plásmidos, utilizados de forma secuencial o simultánea, que se están volviendo cada vez más populares para la edición del genoma o la ingeniería de rutas combinatorias.


Respuestas inmunitarias balanceadas celular y humoral dirigidas a múltiples antígenos en adultos que reciben una vacuna tetravalente inactivada contra la influenza

También existe un artículo revisado por pares de este Preprint.

Yu, E.D. Grifoni, A. Sutherland, A. Voic, H. Wang, E. Frazier, A. Jimenez-Truque, N. Yoder, S. Welsh, S. Wooden, S. Koff, W. Creech, B. Sette, A. da Silva Antunes, R. Respuestas inmunitarias humorales y celulares equilibradas dirigidas a múltiples antígenos en adultos que reciben una vacuna antigripal inactivada cuadrivalente. Vacunas 2021, 9, 426. Yu, E.D. Grifoni, A. Sutherland, A. Voic, H. Wang, E. Frazier, A. Jimenez-Truque, N. Yoder, S. Welsh, S. Wooden, S. Koff, W. Creech, B. Sette, A. da Silva Antunes, R. Respuestas inmunitarias humorales y celulares equilibradas dirigidas a múltiples antígenos en adultos que reciben una vacuna antigripal inactivada cuadrivalente. Vacunas 2021, 9, 426. Copiar

Referencia de la revista: Vaccines 2021, 9, 426
DOI: 10.3390 / vacunas9050426

Citar como:

Yu, E.D. Grifoni, A. Sutherland, A. Voic, H. Wang, E. Frazier, A. Jimenez-Truque, N. Yoder, S. Welsh, S. Wooden, S. Koff, W. Creech, B. Sette, A. da Silva Antunes, R. Respuestas inmunitarias humorales y celulares equilibradas dirigidas a múltiples antígenos en adultos que reciben una vacuna antigripal inactivada cuadrivalente. Vacunas 2021, 9, 426. Yu, E.D. Grifoni, A. Sutherland, A. Voic, H. Wang, E. Frazier, A. Jimenez-Truque, N. Yoder, S. Welsh, S. Wooden, S. Koff, W. Creech, B. Sette, A. da Silva Antunes, R. Respuestas inmunitarias humorales y celulares equilibradas dirigidas a múltiples antígenos en adultos que reciben una vacuna antigripal inactivada cuadrivalente. Vacunas 2021, 9, 426. Copiar


Estrategias de entrega de genes

Biolística

Biolística , abreviatura de "balística biológica" y también conocida como transferencia de genes mediada por partículas, es el método de disparar directamente fragmentos de ADN a las células utilizando un dispositivo llamado pistola de genes.

Para usar una pistola genética, un científico primero mezcla una construcción de ADN con partículas de un metal pesado, generalmente tungsteno u oro. Estas finas partículas se adhieren al ADN cargado negativamente. Las partículas de ADN / metal se cargan en un lado de una bala de plástico (Figura 11.4). Un gas presurizado, generalmente helio, proporciona la fuerza para la pistola. La presión del gas se acumula hasta que se rompe un disco de ruptura, conduciendo la bala de plástico por un eje. La bala de plástico se detiene abruptamente al final del eje, pero las partículas de ADN / metal emergen del arma con gran velocidad y fuerza. Si la pistola apunta al tejido biológico, algunas de las partículas metálicas penetrarán en las membranas celulares y entregarán construcciones de ADN a las células.

Las partículas de metal recubiertas de ADN se colocan en el extremo frontal de una bala. El gas a alta presión empuja la bala por un eje. Al final del eje, la bala está bloqueada, pero las partículas recubiertas de ADN emergen con gran velocidad y fuerza.

Un neurocientífico puede utilizar tecnología biolística para provocar una expresión génica eficiente en las neuronas. Esta tecnología puede producir un patrón de transfección disperso, similar a una tinción de Golgi, en el que solo las células individuales reciben el ADN extraño en un fondo de células no transfectadas. Otra ventaja del uso de la tecnología biolística es que una pistola genética puede administrar ADN a través de tejido relativamente grueso, como un corte de tejido en cultivo. Por lo tanto, es posible transfectar células dentro de un corte que sería difícil de apuntar usando otros métodos de administración de genes. Esta técnica aún no ha tenido éxito en la transfección de neuronas de mamíferos. en vivo, aunque se ha utilizado en vivo para transfectar células del hígado y de la piel. La principal desventaja de usar esta tecnología es que puede causar daño físico a las células. Se requiere optimización para limitar la cantidad de daño tisular causado por la fuerza del impacto de los proyectiles.


Discusión

Durante las últimas décadas, los modelos de roedores transgénicos se han convertido en herramientas poderosas para estudiar la distribución [15, 17, 19] y la función [31,32,33,34] de las neuronas CRH en el cerebro. Con el fin de sondear las características morfológicas de las neuronas CRH a resolución de una sola célula, combinamos el etiquetado genético (utilizando líneas de ratones transgénicos) con la plataforma fMOST para generar conjuntos de datos de imágenes de alta resolución, con los que caracterizamos las morfologías de distintas neuronas CRH distribuidas en varias regiones del cerebro en todo el cerebro del ratón.

La robusta fluorescencia nativa de cada una de estas líneas de ratón informador permitió la visualización directa de estructuras dendríticas y axonales finas de neuronas marcadas, que se ha demostrado que es útil para mapear circuitos neuronales, así como para obtener imágenes y rastrear poblaciones celulares específicas [35,36, 37]. Comparamos los patrones de distribución de neuronas CRH marcadas con fluorescencia en tres líneas de ratón reportero. Encontramos que los ratones adultos CRH-IRES-CreAi6 mostraban el mayor número de neuronas marcadas en varias regiones del cerebro (Fig. 1J). Aunque las tres líneas de ratón se diseñaron de manera similar, los resultados pueden deberse a la sensibilidad a Cre y la fuerza de los indicadores fluorescentes. Las líneas informadoras Ai6 son más sensibles a los niveles bajos de Cre, lo que lleva a una identificación más completa de las poblaciones positivas a Cre [35], y la expresión de la proteína fluorescente mejorada ZsGreen1 fue más fácil de ver. Otra posible explicación es que la recombinación mediada por Cre se había producido en más células en las líneas informadoras Ai14 o Ai32, pero no se detectó debido a la baja expresión del informador. En particular, la proteína de fusión fluorescente, CHR2-EYFP, está unida a la membrana y, por lo tanto, se distribuye a lo largo de la membrana plasmática de los procesos neuronales dentro de los ratones CRH-IRES-CreAi32 [38, 39], lo que permite una visualización clara de toda la morfología neuronal. Por lo tanto, utilizamos ratones CRH-IRES-CreAi32 para imágenes y reconstrucciones de todo el cerebro. Curiosamente, también se observó una gran cantidad de neuronas piramidales corticales marcadas con EYFP en ratones adultos (que no se ha informado anteriormente desde la edad de inicio del día 21 posnatal) (archivo adicional 1, Figura S3).

A continuación, enfocamos nuestros análisis de neuronas reconstruidas principalmente en varias regiones relacionadas con el estrés, incluidas la mPFC, el hipotálamo, la amígdala, la BST y el hipocampo. Por ejemplo, se ha informado que las neuronas que sintetizan CRH locales son prominentes en el PFC [8, 40,41,42,43] y pueden modular las actividades de las neuronas piramidales [7]. Sin embargo, hasta ahora, rara vez se ha informado de las morfologías completas de las neuronas CRH en el mPFC. Aquí, reconstruimos neuronas CRH marcadas con fluorescencia en la columna cortical en la PrL dentro de mPFC a través de las capas 1-4 (Fig. 4A). Es importante destacar que clasificamos los diferentes tipos de neuronas por su profundidad de soma y patrones de arborización (ejemplo enumerado en la Fig. 4B). Por primera vez, mostramos la distribución de neuronas CRH con diferentes tipos morfológicos en diferentes capas corticales. Encontramos que había densas dendritas (Fig.4A) con hinchazones dendríticas (archivo adicional 1, Figura S3, b) en la capa 1 (cuyo soma se ubicaba en la capa 2/3 o en la capa 4), y esas fibras se extendían hasta la superficie de la corteza. Según las ubicaciones dendríticas específicas de la capa y sus diferentes objetivos de proyección, se identificaron varios tipos de patrones de conexión putativos entre neuronas CRH en la corteza (enumerados en la figura 4F-H). Un patrón de conexión dendrítica tan diverso de neuronas CRH corticales puede reflejar la inervación diferencial de los objetivos de salida aguas abajo (cada subfigura amplificada se muestra en la Fig. 4F-H). Por lo tanto, al caracterizar sus ubicaciones somáticas y las morfologías dendríticas locales respectivas únicas de las neuronas CRH, nuestro estudio actual no solo aumenta nuestra comprensión actual de la distribución de las neuronas CRH, sino que también permite que los estudios futuros profundicen más en las clasificaciones específicas de las células. Tomados en conjunto, estos hallazgos pueden ayudar a elaborar futuros estudios funcionales de neuronas CRH morfológicamente diversas en el PFC.

Es importante destacar que la CRH funciona como una hormona neuropéptida producida en las neuronas neuroendocrinas del PVN y regula la síntesis y secreción de glucocorticoides de las glándulas suprarrenales mediante la acción de la hormona adrenocorticotrópica. Por primera vez, reconstruimos las morfologías intactas de las neuronas CRH y sus varicosidades neuríticas ubicadas dentro de las dendritas (Fig. 5E) en las neuronas PaAp (Fig. 5A, B) y Pe CRH (Fig. 5C, D). En el PaAp, la mayoría de las dendritas con varices se proyectan rostralmente (Fig. 5B), mientras que en el Pe, los extremos de las dendritas se extienden hasta el tercer ventrículo y las varicosidades grandes se unen a las células ependimarias (Fig. 5C-D, G). Además, identificamos que estas varices dendríticas contenían la proteína asociada a vesículas de núcleo denso grande, ChgB, y motores moleculares (por ejemplo, quinesinas) utilizados para el transporte y tráfico intracelular. Curiosamente, una serie de varicosidades al final de una dendrita ubicada cerca de la capa exterior de las células ependimarias al tercer ventrículo que eran inmunopositivas para ChgB (Fig. 5G). Además, no había fibras CRH marcadas con EYFP distribuidas en las células ependimarias o pasadas a través de las células. Estos resultados sugirieron que las fibras de las neuronas CRH en el Pe hacen contacto directo con las células ependimarias y pueden liberarse al tercer ventrículo por las células ependimarias. Por lo tanto, especulamos que estas neuronas endocrinas CRH son diferentes de las que se proyectan a la eminencia media y que las dendritas también pueden liberar CRH a otras áreas del hipotálamo o líquido cefalorraquídeo para participar en sus funciones reguladoras. Además, encontramos una correlación negativa entre el volumen somático y el número de varices en la PaAp (Fig. 5L). Por lo tanto, nuestras características morfológicas reconstruidas de las varicosidades dendríticas pueden facilitar las clasificaciones futuras (de acuerdo con las diferentes orientaciones de las fibras y los patrones de distribución de las varicosidades) de las neuronas CRH hipotalámicas y avanzar en nuestra comprensión de sus funciones potencialmente diversas.

Las neuronas de CRH reconstruidas en diferentes regiones del cerebro mostraron diversos patrones de distribución y morfologías (Fig. 3a-h). Encontramos que algunas neuronas compartían una forma bipolar común en varias regiones del cerebro (Fig. 3i), especialmente en el hipotálamo (75% en PaAp, 100% en SCN) y corteza. Se ha informado que las neuronas neuroendocrinas parvocelulares CRH típicamente tienen dos dendritas primarias relativamente gruesas que se extienden desde lados opuestos del soma en una disposición bipolar y se ramifican una vez [44, 45] además, las células bipolares se encuentran comúnmente en la corteza [12, 46 , 47]. Por lo tanto, nuestro presente estudio en ratones reporteros de CRH es consistente con estos estudios previos y es el primero en describir las estructuras neurales específicas de estas neuronas CRH, tales como los diferentes tipos de conexiones entre las neuronas CRH en la mPFC, así como las intactas. morfologías de varicosidades dendríticas en neuronas CRH hipotalámicas. Estas propiedades de ramificación simplificadas de estas neuronas CRH en el hipotálamo pueden favorecer sus funciones endocrinas. Entre todas las neuronas CRH reconstruidas en diferentes regiones del cerebro, sus somas tenían diferentes tamaños (Fig. 3j), siendo los somas en LSD, VMPO e hipocampo más grandes que los de PaAp, Pe y SCN. Además, encontramos complejidades diferenciales de las ramas dendríticas en estas regiones. Por ejemplo, las neuronas CRH en mPFC, LSD e hipocampo exhibieron morfologías dendríticas más complejas en comparación con las de PaAP, Pe y SCN (fig. 3k-1). Hupalo y col. demostraron que la activación quimiogenética de las neuronas dmPFC CRH caudal pero no rostral dañaba la memoria de trabajo, mientras que la inhibición de estas neuronas mejoraba la memoria de trabajo [29]. Además, CRH actúa en el tabique medial para deteriorar la memoria espacial [48] y actúa en el BNST para participar en conductas desadaptativas inducidas por estrés [49]. Sin embargo, las funciones de CRH en OB, SCN y VMPO siguen sin estar claras. Por lo tanto, nuestro estudio actual puede proporcionar una base morfológica detallada para futuros estudios basados ​​en funciones sobre las neuronas CRH en estas diferentes regiones del cerebro. Curiosamente, PaAP, Pe y SCN están todos contenidos dentro del hipotálamo, y las neuronas CRH en estas regiones tenían somas más pequeños y exhibían patrones de ramificación bipolar más prevalentes en comparación con los de otras regiones del cerebro analizadas en nuestro estudio actual. En el PVN, las neuronas CRH se han identificado como células parvocelulares [44, 50]. Encontramos que el volumen somático medio de las neuronas CRH en el Pe era mayor que el de las neuronas CRH en el PaAP (Fig. 5H). Por lo tanto, especulamos que estos datos pueden ser indicativos de dos tipos diferentes de neuronas endocrinas CRH dentro del hipotálamo. En conjunto, nuestro análisis cuantitativo de estas reconstrucciones demuestra una diversidad específica de la región de neuronas CRH en términos de tamaño somático y complejidad de ramificación.

Se cree convencionalmente que las espinas dendríticas están en gran parte ausentes de las neuronas inhibidoras. Estudios previos de otros grupos y nuestra investigación anterior han demostrado que las neuronas CRH son neuronas GABAérgicas que se encuentran en muchas regiones cerebrales diferentes, como en la corteza [30] y el hipocampo, además, las neuronas CRH suelen ser espinosas, mientras que algunas se proyectan de largo alcance. Se ha informado que las neuronas CRH en BST y CeA tienen espinas [38]. En nuestro presente estudio, se detectó el patrón dependiente de arborización de las espinas dendríticas de las neuronas CRH donde los tipos más sofisticados de espinas en la amígdala extendida (BST y CeA) y el más simple en el hipotálamo (VMPO y SCN). Curiosamente, aunque se confirmaron neuronas CRH espinosas GABAérgicas en BST y CeA, también se encontraron neuronas CRH espinosas en estas áreas.


DISCUSIÓN

Los resultados presentados aquí demuestran la fuerza y ​​versatilidad del etiquetado genético multicolor en el pez cebra y proporcionan herramientas bien caracterizadas y métodos validados que pueden adoptarse fácilmente. los ubi: Zebrabow y UAS: Zebrabow Las líneas son adecuadas para el marcaje multicolor amplio y específico de tejido: el color se hereda fielmente entre las células hijas y es estable en el tiempo, y se pueden identificar estructuras similares a clones en tejidos que van desde la córnea y el prosencéfalo hasta la aleta caudal y el cartílago. Como las diferentes combinaciones de Zebrabow y Cre tienen distintas ventajas (Tablas 2 y 3), los investigadores pueden seleccionar entre una amplia gama de enfoques para satisfacer sus necesidades de obtención de imágenes. Por lo tanto, Zebrabow proporciona los recursos necesarios para estudios anatómicos y de linaje sistemáticos durante el desarrollo del pez cebra.

Optimización de la estabilidad y la diversidad del color

Nuestros resultados muestran que los colores de Zebrabow se mantienen estables a lo largo del tiempo. Sin embargo, los colores solo se vuelven estables después del establecimiento y la maduración del color. Primero, Cre necesita expresarse y luego recombinar los sitios Lox. En segundo lugar, la concentración de proteína fluorescente debe alcanzar un estado estable. Los fluoróforos no predeterminados (CFP e YFP) necesitan tiempo para acumularse, mientras que el fluoróforo predeterminado (RFP) necesita tiempo para degradarse. Por lo tanto, la tasa de maduración del color depende del momento de la recombinación de Cre, la cantidad de RFP residual y la acumulación de CFP e YFP maduras. Una forma de minimizar el tiempo de maduración es inducir la recombinación mediada por Cre antes de la acumulación significativa de RFP. Para mantener la estabilidad del color, también es esencial que la actividad de Cre sea transitoria para que la expresión de RFP no se cambie continuamente a la expresión de CFP o YFP.

Las condiciones de la imagen también influyen en la estabilidad del color. Las diferentes proteínas fluorescentes tienen diferentes perfiles de fotoestabilidad, espectros de excitación y emisión y capacidades para resistir la fijación (Shaner et al., 2008 Shaner et al., 2005 Weissman et al., 2011). Estos factores pueden afectar el color después de la preparación de la muestra y la obtención de imágenes. Por ejemplo, en tejidos más profundos, la luz de longitud de onda más larga (emitida por RFP) se dispersará menos que la luz de longitud de onda más corta. Nos hemos centrado en estructuras más superficiales porque la obtención de imágenes más allá de la profundidad de 200-300 μm sigue siendo un desafío. Será interesante probar si los avances recientes en microscopía o técnicas de limpieza de tejidos mejorarán las imágenes de Zebrabow en estructuras más profundas (Hama et al., 2011 Kaufmann et al., 2012 Keller et al., 2008 Kuwajima et al., 2013). La intensa excitación del láser también puede sesgar la relación relativa de los tres fluoróforos porque RFP y CFP son menos fotoestables que YFP (Weissman et al., 2011). Nuestros resultados muestran la capacidad de Zebrabow para generar colores estables, pero el establecimiento y la estabilidad del color deben probarse empíricamente.

La diversidad de colores es otra variable importante en las imágenes multicolores. La alta diversidad de colores hace que cada célula sea más rastreable y reduce la posibilidad de que diferentes clones tengan colores idénticos. Nuestros resultados muestran que los perfiles de color de Zebrabow cambian en una trayectoria predecible en respuesta al aumento de los niveles de Cre y la actividad. Siempre que la actividad de Cre sea sintonizable (con choque térmico o tamoxifeno), es posible generar una diversidad de color óptima. También encontramos que el número de células que se han recombinado aumenta con el aumento de la actividad Cre. La recombinación tiene lugar en menos células en condiciones de baja diversidad de color y en más células en condiciones de alta diversidad. En aplicaciones en las que se requieren tanto un etiquetado escaso como una gran diversidad de colores, los enfoques de trasplante (p. Ej. ubi: Zebrabow en tipo salvaje) se puede utilizar para reducir la densidad de etiquetado (datos no mostrados).

Análisis clonales

Nuestro estudio demuestra que Zebrabow tiene el potencial para el análisis clonal en una amplia variedad de tejidos, incluidos la córnea, el cerebro, los músculos, los cartílagos y la vasculatura. La diversidad de grupos similares a clones en diferentes órganos sugiere diferentes modos de expansión de progenitores durante la organogénesis. Por ejemplo, la presencia de grandes grupos cohesivos sugiere no solo una rápida proliferación de un pequeño grupo de células progenitoras, sino también una dispersión limitada de las células hijas desde su sitio de origen. Estos aspectos del comportamiento celular se pueden estudiar fácilmente con las técnicas utilizadas aquí.

Los clones putativos pueden identificarse no solo por los colores compartidos de los grupos cohesivos, sino que también se puede usar el color para determinar si las células dispersas pueden estar relacionadas clonalmente. En comparación con el etiquetado simple o doble, la amplia diversidad de colores en Zebrabow reduce la probabilidad de que las células no relacionadas tengan el mismo color. Sin embargo, la dispersión extensa de células con colores similares puede dificultar la asignación inequívoca de relaciones clonales. Un enfoque para ayudar a identificar los clones sería comparar el número de células por clon de un solo color (tamaño del clon) a diferente densidad de etiquetado: si las células con el mismo color están relacionadas clonalmente, el tamaño del clon será el mismo independientemente de la densidad de etiquetado. Por el contrario, si muchas células no relacionadas comparten el mismo color, el tamaño del clon aumentaría con la densidad de etiquetado. Dichos cálculos se han realizado en análisis clonales retrovirales y podrían aplicarse al análisis de color (Galileo et al., 1990).

En la córnea, se ha creído durante mucho tiempo que las células madre epiteliales están ubicadas exclusivamente en el limbo y que los clones corneales se forman por crecimiento centrípeto del limbo (Davies y Di Girolamo, 2010 Lavker et al., 2004). Curiosamente, la nueva evidencia sugiere que las células madre de la córnea podrían estar esparcidas por toda la córnea y que los clones de la córnea pueden formarse por crecimiento centrífugo, en lugar de centrípeto (Majo et al., 2008). Encontramos que muchos clones corneales de pez cebra se derivan de la córnea periférica, una región análoga al limbo. Aunque nuestros resultados no excluyen la posibilidad de que un subconjunto de clones pueda originarse en la córnea central, la obtención de imágenes de lapso de tiempo de clones individuales sugiere que los clones de la córnea se forman por expansión centrípeta de clones derivados del limbo. Estos resultados demuestran que el recurso Zebrabow descrito aquí es ideal para abordar cuestiones fundamentales en organogénesis y homeostasis tisular.


Usando CRISPR, una nueva técnica facilita el mapeo de redes genéticas

Crédito: CC0 Public Domain

CRISPR-Cas9 facilita la desactivación o modificación de un solo gen para determinar su efecto en un organismo o célula, o incluso en otro gen. Pero, ¿qué pasaría si pudiera realizar varios miles de experimentos a la vez, utilizando CRISPR para modificar cada gen en el genoma individualmente y ver rápidamente el impacto de cada uno?

Un equipo de científicos de la Universidad de California, Berkeley, ha desarrollado una manera fácil de hacer precisamente eso, que permite a cualquiera perfilar una célula, incluidas las células humanas, y determinar rápidamente todas las secuencias de ADN en el genoma que regulan la expresión de un gen específico.

Si bien la técnica beneficiará principalmente a los investigadores básicos que estén interesados ​​en rastrear la cascada de actividad genética (la red genética) que impacta un gen en el que están interesados, también ayudará a los investigadores a encontrar rápidamente las secuencias reguladoras que controlan los genes de enfermedades y posiblemente encontrar nuevos objetivos para las drogas.

"Una enfermedad en la que es posible que desee utilizar este enfoque es el cáncer, donde conocemos ciertos genes que esas células cancerosas expresan y necesitan expresar para sobrevivir y crecer", dijo Nicholas Ingolia, profesor asociado de UC Berkeley biología. "Lo que esta herramienta le permitiría hacer es formular la pregunta: ¿Cuáles son los genes ascendentes, cuáles son los reguladores que controlan esos genes que conocemos?"

Es posible que esos controladores sean más fáciles de apuntar terapéuticamente para apagar las células cancerosas.

La nueva técnica simplifica algo que ha sido difícil de hacer hasta ahora: retroceder a lo largo de las vías genéticas en una célula para encontrar estos controladores definitivos.

"Tenemos muchas buenas formas de avanzar", dijo. "Esta es una buena forma de trabajar hacia atrás, averiguar qué es lo que hay antes de algo. Creo que tiene muchos usos potenciales en la investigación de enfermedades".

"A veces utilizo la analogía de que cuando entramos en una habitación oscura y activamos un interruptor de luz, podemos ver qué luz se enciende. Esa luz es como un gen, y podemos decir, cuando activamos el interruptor, qué genes se enciende. Ya somos muy buenos en eso ", agregó. "Lo que esto nos permite hacer es trabajar al revés. Si tenemos una luz que nos importa, queremos saber cuáles son los interruptores que la controlan. Esto nos da una manera de hacerlo".

Ryan Muller, un estudiante de posgrado en el laboratorio de Ingolia, y sus colegas Lucas Ferguson y Zuriah Meacham, junto con Ingolia, publicarán los detalles de su técnica en línea el 10 de diciembre en la revista. Ciencias.

Desde el advenimiento de la edición de genes CRISPR-Cas9 hace ocho años, los investigadores que desean determinar la función de un gen específico han podido apuntarlo con precisión con la proteína Cas9 y eliminarlo. Guiada por un fragmento de ARN guía complementario al ADN en el gen, la proteína Cas9 se une al gen y lo corta o, como ocurre con la interferencia CRISPR (CRISPRi), lo inhibe.

En el tipo de ensayo más crudo, la célula u organismo vive o muere. Sin embargo, es posible buscar efectos más sutiles del nocaut, como si un gen específico está activado o desactivado, o cuánto está activado o desactivado.

Hoy en día, eso requiere agregar un gen informador, a menudo uno que codifica una proteína verde fluorescente, unido a una copia idéntica del promotor que inicia la expresión del gen que le interesa. Dado que el promotor único de cada gen determina cuándo se expresa ese gen , si el knockout Cas9 afecta la expresión de su gen de interés, también afectará la expresión del reportero, haciendo que el cultivo brille en verde bajo luz fluorescente.

Sin embargo, con 6.000 genes en total en levaduras y 20.000 genes en humanos en total, es una gran empresa modificar cada gen y descubrir el efecto en un reportero fluorescente.

"CRISPR facilita el estudio exhaustivo de todos los genes del genoma y los perturba, pero la gran pregunta es, ¿cómo se pueden leer los efectos de cada una de esas perturbaciones?" él dijo.

Esta nueva técnica, que Ingolia llama interferencia CRISPR con secuenciación del reportero de expresión de código de barras, o CiBER-seq, resuelve ese problema, permitiendo que estos experimentos se realicen simultáneamente al combinar decenas de miles de experimentos CRISPR. La técnica elimina la fluorescencia y emplea una secuenciación profunda para medir directamente la actividad aumentada o disminuida de los genes en el conjunto. La secuenciación profunda utiliza tecnología de secuenciación de próxima generación de lectura prolongada y alto rendimiento para secuenciar y esencialmente contar todos los genes expresados ​​en las muestras agrupadas.

"En un experimento CiBER-seq agrupado, en un día, podemos encontrar todos los reguladores ascendentes para varios genes diana diferentes, mientras que, si utilizara una técnica basada en fluorescencia, cada uno de esos objetivos le llevaría varios días de medición. tiempo ", dijo Ingolia.

CRISPRing cada gen en un organismo en paralelo es sencillo, gracias a las empresas que venden ARN de guía única listos para usar para usar con la proteína Cas9. Los investigadores pueden solicitar sgRNA para cada gen del genoma, y ​​para cada gen, una docena de sgRNA diferentes; la mayoría de los genes son cadenas de miles de nucleótidos, mientras que los sgRNA tienen una longitud de aproximadamente 20 nucleótidos.

La innovación clave del equipo fue vincular cada sgRNA con una secuencia de nucleótidos aleatoria única, esencialmente, un código de barras, conectada a un promotor que solo transcribirá el código de barras si el gen de interés también está activado. Cada código de barras informa sobre el efecto de un sgRNA, dirigido individualmente a un gen de un conjunto complejo de miles de sgRNA. La secuenciación profunda le dice la abundancia relativa de cada código de barras en la muestra (para levadura, unos 60.000), lo que le permite evaluar rápidamente cuál de los 6.000 genes de la levadura tiene un efecto sobre el promotor y, por lo tanto, la expresión del gen de interés. Para las células humanas, un investigador podría insertar más de 200.000 ARN guía diferentes, dirigidos a cada gen varias veces.

"Este es realmente el corazón de lo que pudimos hacer de manera diferente: la idea de que tienes una gran biblioteca de diferentes ARN guía, cada uno de los cuales va a perturbar un gen diferente, pero tiene el mismo promotor de consulta: el respuesta que estás estudiando. Ese promotor de consultas transcribe el código de barras aleatorio que enlazamos a cada guía ”, dijo. "Si hay una respuesta que le interesa, pincha cada gen diferente en el genoma y observa cómo cambia la respuesta".

Si obtiene un código de barras que es 10 veces más abundante que cualquiera de los demás, por ejemplo, eso le indica que ese promotor de consultas está activado 10 veces más fuertemente en esa celda. En la práctica, Ingolia adjuntó aproximadamente cuatro códigos de barras diferentes a cada ARN guía, como una verificación cuádruple de los resultados.

"Al observar más directamente una respuesta de expresión génica, podemos captar mucha sutileza de la fisiología misma, lo que está sucediendo dentro de la célula", dijo.

En los experimentos recientemente informados, el equipo investigó cinco genes separados en levadura, incluidos genes involucrados en el metabolismo, la división celular y la respuesta de la célula al estrés. Si bien es posible estudiar hasta 100 genes simultáneamente cuando se realiza CRISPR en todo el genoma, sospecha que, por conveniencia, los investigadores se limitarían a cuatro o cinco a la vez.


Ingeniería genética en los alimentos: el jurado y los n. ° 8217 aún deliberan

La ingeniería genética en los alimentos se puede utilizar para la producción de frutas, verduras y cultivos alimentarios mejorados. Pero debe manejarse con responsabilidad. Lea este artículo de BiologyWise para explorar el mundo de la ingeniería genética de los alimentos.

La ingeniería genética en los alimentos se puede utilizar para la producción de frutas, verduras y cultivos alimentarios mejorados. Pero debe manejarse con responsabilidad. Lea este artículo de BiologyWise para explorar el mundo de la ingeniería genética de los alimentos.

La ingeniería genética se ocupa de la manipulación directa de genes de organismos. Para lograrlo se utilizan técnicas como la clonación y la transformación molecular. With the help of these techniques, the genetic structures and characteristics of a life form can be altered.

Would you like to write for us? Well, we're looking for good writers who want to spread the word. Get in touch with us and we'll talk.

En molecular cloning, a DNA sequence is isolated and its multiple copies are obtained. This technique is often used in the amplification of DNA sequences. In the transformación technique, a change is brought about in the genetic structure of a cell by introducing a foreign DNA into it.

A segment of DNA is a protein sequence. By changing this sequence, different versions of that protein can be obtained. Until now, genetic engineering has been successfully applied for the improvement of crops and in the manufacture of medicines to a certain extent. It has been used in the alteration of genes in organisms to develop improved versions of the species.

How are genetic engineering techniques used to modify crops?

  • The most common method is of using a gene gun to introduce genes into plant cells. DNA bound to particles of gold or tungsten are shot into the plant tissue or cells, under high pressure. The particles penetrate the cell wall and membranes, DNA separates from the metal and integrates itself in the plant DNA inside the nucleus.
  • In the Agrobacterium tumefaciens-mediated technique, Agrobacteria introduce their genes into plant hosts.
  • In case of electroporation, DNA enters plant cells through small pores created by electric pulses.
  • In microinjection, genes are injected into the DNA.

Genetic engineering to introduce new traits in plants, can lead to increase in their yield, improve agricultural practices, and improve the nutritional value of food. Plants tolerant to weed killers, allow farmers to kill weeds without worrying about the crops. The advantages of herbicide or insecticide-resistant crops are similar. The future of genetically engineering crops could be the development of edible vaccines. Development of potatoes with edible vaccines for diarrhea, and cultivation of tobacco with antibodies for dental caries, is in the stage of pre-clinical human trials.

Out of the three important cereals namely wheat, rice, and corn, wheat was the last to be transformed genetically. Recombinant DNA techniques were used to create the first transgenic wheat around the 1980s.

Biotecnología is the term used for genetic engineering in food. As the name suggests, it is a technology based on biology. It deals with agriculture, medicine, and food science. Before 1971, this term was used in relation with the agriculture and food processing industries.

By the use of genetic engineering, genes can be transferred to a developed variety of crop to achieve a higher yield. The transfer of genes which impart the characteristic of greater yield, is critical. But it is also one of the most beneficial applications of genetic engineering in food. With the help of genetic engineering techniques, certain desirable traits are introduced in crops, which include pest resistance, improvement in the crop’s nutrient profile, or resistance to environmental conditions and chemical treatments.

An antibiotic-resistant tobacco plant cultivated in 1982 was the first genetically modified crop. Field trials to produce insect-resistant tobacco plants occurred for the first time in the USA and France. China was the first country to allow the use of transgenic plants.

Would you like to write for us? Well, we're looking for good writers who want to spread the word. Get in touch with us and we'll talk.

Biotechnology can be used to improve the nutritional value of foods. This is indeed an application of great potential. Along with the improvement in nutrition, a better taste can be imparted to foods by engineering them genetically. This requires the use of biotechnology to slow down the process of food spoilage. It can result in the production of fruits and vegetables that have a longer shelf life. Perishability of foods can be reduced to a great extent, thus giving a boost to the agriculture and food industry.

Tomates were the first food crop with an edible fruit where it was possible to insert genetic material in the cell’s chloroplast and chromoplast plastomes. They have been genetically engineered to study fruit ripening. Those with an antifreeze gene were developed to make them frost-tolerant. They were tested to improve their tolerance to cold and drought. They have been altered to develop resistance to bacterium bacilo turingiensico and to improve their nutrient profile and taste.

Recently, researchers have identified a plant gene called At-DBF2, which when transferred to tomato and tobacco cells, increases their endurance to harsh soil and climatic conditions. It is often seen that certain types of soils or climatic conditions in certain regions, are the reasons for less growth of the crops there. This limitation can be overcome by genes that impart a withstanding capacity to crops. Similarly, it is good if genetic engineering can reduce the dependability of crops on fertilizers. It can make the plants tolerant to herbicides and resistant to harmful insects and pests.

In 1999, the first virus-resistant papayas were commercially grown in Hawaii. The University of Hawaii started developing a papaya cultivar resistant to Papaya Ringspot virus. Viral genes encoding capsid proteins were transferred to the papaya genome. The proteins generate an immune response-like reaction, making the papaya immune or unsusceptible to the ringspot infection. Genetically modified papayas are approved for consumption in the USA and Canada, but not in the European Union.

Genetic engineering can be used to produce new substances such as proteins or other nutrients in food. Foods can be genetically modified to increase their medicinal value. Researchers see edible vaccines as a potential use of genetic engineering in food. This will give rise to homegrown vaccinations and easily available medicines. The costs incurred in their transportation and other costs involved will substantially reduce, leading to cost-effectiveness in medications. Corn has been engineered to produce pharmaceuticals.

Certain corn strains are genetically engineered to introduce desirable traits in them. Cultivars resistant to glyphosate herbicides were brought into commercial use in Monsanto in the year 1996. This corn variety was called the Roundup Ready Corn. Liberty Link corn variety, resistant to glufosinate was developed by Bayer CropScience.

Maize has been genetically modified to express proteins from the bacteria bacilo turingiensico, which is poisonous to certain insect pests. This corn variant is known as Bt corn. Lately, corn varieties resistant to ear worms and root worms have been developed. In 2013, drought tolerance was introduced into corn. These corn hybrids were known as DroughtGard and were produced in Monsanto.

This Isn’t True!

You may come across images like these, but the cross of apples with oranges is not a reality. Oranges cannot cross produce with apples as the two belong to different species. Their crossing would require gene splicing, which is difficult. Heard of the phrase ‘mixing apples and oranges’? Idiomatically, it means mixing two totally different things. And scientifically speaking too, apples and oranges no poder be genetically combined.

Criticism

The darker side of genetic engineering in food is that the processes involve the use of herbicides and contamination of genes in crops. Horizontal gene transfer and recombination can give rise to new pathogens. It may introduce virulency among pathogens. If certain resistance genes spread in the harmful bacteria themselves, we may waste our defenses to diseases. By genetically engineering food, we are in a way ignoring the possibility that transgenic life forms could be harmful.

Genetically engineered crops may supersede natural weeds. Genetic engineering in food may prove to be dangerous to other weeds and natural organisms. The self-replication of genetically modified life forms might render us helpless in controlling their production and growth.

If not done with great care, genetic engineering can have negative side effects on food. It can lead to undesirable mutations in genes. It may produce allergies in crops. Moreover, in case of genetically modified seeds, all of them are identical in their genetic structure. This might cause a widespread failure of a crop due to a pest attack. Some argue that in refining the appearance and taste of food, its nutritional value may be compromised.

This makes us realize that the seemingly rosy picture of genetic engineering in food may prove to be thorny too. Genetic engineering should be used with responsibility. High standards should be exercised to ensure safety in the genetically engineered foods. The bottom line is that before we introduce genetic alterations in food, we should have a clear understanding of their dangers. Failing to understand the negative aspects of genetic modification of foods, may pose a risk to our health and safety.

Related Posts

Learn some genetic engineering ethics when it comes to practices like cloning, that are in the eyes of many, immoral and a perverse attack on creation.

Genetic engineering process manipulates the DNA sequence to create a new one. The write-up focuses on the various benefits of genetic engineering.

Of late, there has been great debate over the process of human cloning. Whether it is ethical or unethical, genetic cloning is always seen as the greatest challenge in genetic&hellip


Can a cell receive multiple copies of an insert when using different MOIs? - biología

The Science of Biotechnology

Discovering and Developing Medicines

How Are Biotech Medicines Made?


The Science of Biotechnology

Biotechnology has been used in a rudimentary form since ancient brewers began using yeast cultures to make beer. The breakthrough that laid the groundwork for modern biotechnology came when the structure of DNA was discovered in the early 1950s. To understand how this insight eventually led to biotech therapies, it&rsquos helpful to have a basic understanding of DNA&rsquos central role in health and disease.


Illustration is copyrighted material of BioTech Primer, Inc., and is reproduced herein with its permission.

What does DNA do?
DNA is a very long and coiled molecule found in the nucleus, or command center, of a cell. It provides the full blueprint for the construction and operation of a life-form, be it a microbe, a bird, or a human. The information in DNA is stored as a code made up of four basic building blocks, called nucleotides. The order in which the nucleotides appear is akin to the order of the letters that spell words and form sentences and stories. In the case of DNA, the order of nucleotides forms different genes. Each gene contains the instructions for a specific protein.

With a few exceptions, every cell in an organism holds a complete copy of that organism&rsquos DNA. The genes in the DNA of a particular cell can be either active (turned on) or inactive (turned off) depending on the cell&rsquos function and needs. Once a gene is activated, the information it holds is used for making, or &ldquoexpressing,&rdquo the protein for which it codes. Many diseases result from genes that are improperly turned on or off.


Métodos

DNA Constructs and Reagents

BAC Clones RP23-412o5 and RP23-395m11 were obtained from Children's Hospital Research Institute (CHORI). BACLink -GM and -SP linking vectors were generously provided by Claire Huxley [10]. pLD53-SCAEB recombination vector was generously provided by Shiaoching Gong [8] and the mini lamda vector was generously provided by Donald M. Court [19]. Homology Arms were amplified using Pfx DNA polymerase (Invitrogen) and amplified using an icycler (Biorad).

Cloning Homology Arms into BACLinking Vectors

Trap homology arm 3 was amplified using oligos SPA3 5'TRAP (ACACCTCGAGTTGTCACTTACCAGGCAAGCTGTGACA) containing an Xho1 site and SPA3 3'TRAP (TCTCGGATCCTTCTGTCGACGGCAGAGGCAGGCGGATTTTGAGTT) containing a BamH1 and internal Sal1 site. Homology arm 3 was digested with Xho1/BamH1 and cloned into the Sal1/Bamh1 site of BacLink-SP using conventional cloning practices. Dmp1 homology arm 2 was amplified using the oligos SPA2 5'DMP (TCTCGTCGACCATCTATTTATACAATTGCTCACTGAG) containing a Sal1 site and SPA2 3'DMP (TCTCGGATCCCTCTATTATAAACTGCTGTGTGTCTAAG) containing a BamH1 site and subsequently cloned into the Sal1/BamH1 site of BacLink SP-TRAP-A3 to create BACLink SP-TRAP/DMP A3/A2. Ibsp homology arm 1 was amplified using the oligos SPA1 5'IBSP (TCTCCTCGAGGTCCTTTCTACAATACTTAGAAACTTAAGT) containing an Xho1 site and SPA1 3'IBSP (TCTCACGCGTTCTATTGGTAACCTGCCATTTTCCCTTAGA) containing a Mlu1 site. Arm1 was then cloned into the Mlu1/Xho1 site of BACLink SP-TRAP/DMP A3/A2 to create BACLink SP-TRAP/DMP/IBSP. This vector was then used to capture a genomic DNA fragment containing the genes DMP1 y IBSP described below. TRAP homology arm 4 was amplified using the oligos GMA4 5'TRAP (TCTCGTCGACTGGCACGTGGGATAAGTCTATGCATGT) containing a Sal1 site and GMA4 3'TRAP (CTCTGGATCCCAGTAGCTACCACTTGCTGGTTTTGAG) containing a BamH1 site and cloned into the Sal1/BamH1 site of BACLink-GM to create BACLink-GM TRAP-A4. TRAP homology arm 3 was amplified using oligos GMA3 5'TRAP (ACACCTCGAGTTGTCACTTACCAGGCAAGCTGTGACA) containing an Xho1 site and GMA3 3'TRAP (TCTCACGCGTGGCAGAGGCAGGCGGATTTTGAGTTCA) containing an Mlu1 site and cloned into the Xho1/Mlu1 site of BACLink-GM TRAP-A4 to create BACLink-GM TRAP-A3/A4. This vector was subsequently used to capture a genomic DNA region of the TRAP gene.

Subcloning Genes into BAC Linking vectors

RP23-412o5 and RP23-395m11 containing DH10B were made electrocompetent and transformed with mini lamda [19]. Colonies were selected for on Chloramphenicol (12.5 ug/ml) and Tetracycline (10 ug/ml) LB Agar plates and grown at 32c. Resistant colonies were expanded and made electrocompetent. To prepare electrocompetent cells containing mini lamda, cells were maintained at 32c, but at the end of the growth phase were heat shocked at 42c for 15 minutes to activate the Red Recombinase System. BACLink SP TRAP/DMP/IBSP was double digested with Not1/SacI and transformed into RP23-395m11/mini lamda bacteria and selected for on spectinomycin (50 ug/ml) resistant LB Agar plates. BACLink GM TRAP A3/A4 was digested with Xho I and transformed into RP23-412o5/mini lamda bacteria and selected for on gentamicin (5 ug/ml) resistant plates. Recombinants were initially screened by colony PCR where oligos were designed flanking homology arms, one being present in the vector and the other being present on the other side of the homology arm. Para el DMP1/IBSP genomic DNA fragment oligos SP2 (GCCCTACACAAATTGGGAGA) and DMPR (ACTCTTTCCTTAAAGATATCAATTTAC) were used to screen the DMP1 end and Belo2658 (TTTGTCACAGGGTTAAGGGC) and IBSPR (TCTGCTGATGTGTCCACCAGCACTAAG) were used to screen the IBSP fin. Para el TRAP genomic DNA fragment oligos Belo 2658 and TRAP-A3R (AATTACAGATTTGTGAGATAGTCACAC) were used to screen the arm 3 end and GM5'end (CGTAACATCGTTGCTGCTGCGTAACAT) and TRAP-A4R (CCGCAGATGGACTTCTGTCCAGCTGAG) were used to screen the arm 4 end. Potential BAC subclones positively identified by PCR were further verified by restriction digested followed by FIGE.

Cloning of Homology Arms into pLD53 Vectors

Homology Arms were cloned into pLD53 Vectors using standard cloning practices. Homology arms were PCR amplified using PFX polymerase from RP23-412o5 and RP23-395m11 BAC clones. Two homology arms were amplified for each gene (referred to as arms A, B, C, D, E, & F). Primer sequences are as follows: TRAPBox E5'Mlu (TCTCACGCGTGAAGTCCAGTGCTCACATGAC), TRAPBoxE3' Not (AGTGGCGGCCGCCCATGAATCCATCTGTGAGGAAGAGAG), TRAPBoxF5'PAC1 (GTGCTTAATTAAGCGCTGACTTCATCATGTCTC), TRAPBoxF3'PAC1 (GTGCTTAATTAAGACATACACACAGACACACAC), IBSPBoxA5'Mlu (TCTCACGCGTCTGTGAAGTATTCAAGGTACTC), IBSPBoxA3'NHE (CTAGCTAGCTGCAATTTCTTCTG CAATTGAAG), IBSPBoxB5'BSIW1(GATCGTACGGACTGCTTTAATTTTGCTCAGC), IBSPBoxB3'PAC1 (GTGCTTAATTAATATCACTGGCTCTACTGTCAGTC), DMP1BoxCMlu (TCTCACGCGTGCTTCTGAG TTGGTGGAGAGATAC), DMP1BoxC3'NHE1(CTAGCTAGCGGATGCGATTCCTCTACCTGTAATGAAAG), DMP1 BoxD5'BSIW1/Cla1 (CATCGTACGATCGATGACTGTCATTCTCCTTGTGTTCC) DMP1BoxD 3'BSIW1(GATCGTACGGGATCGTAGTTCATACTACTTAC) Amplified products were run through a PCR clean up column (Qiagen), restriction digested and gel purified (Zymogen). Plasmids were digested and then briefly treated with Calf Intestinal Alkaline Phosphatase (New England Biolabs) followed by phenol chloroform extraction and precipitation. Vector and inserted were mixed, ligated at room temperature for 1 hour and electroporated into PIR2 cells. Transformants were selected on LB plates with ampicillin (50 ug/ml).

Inserting Fluorescent Proteins into Genes

After cloning in homology arms A and B, 1 ug of pLD53 was electroporated into 40 ul of electrocompetent bacteria containing the BAC clone of interest. Bacteria were grown for 1 hour in SOC media by shaking at 37c without antibiotic selection. The entire transformation suspension was plated onto LB plates with the appropriate antibiotics (ampicillin 50 ug/ml, gentamicin 5 ug/ml, spectinomycin 50 ug/ml). Ten colonies were picked and re-streaked onto a new plate and grown overnight. The next morning the ten colonies were grown in 1 ml LB media containing the appropriate antibiotic. When bacteria growth appeared, 50–100 ul of LB was taken to screen for an arm A recombination event by colony PCR. PCR primers were designed to flank the A homology arm. Gene specific sense primers were: TRAPrecomA (ACACATTACCATCAGACCCTG), IBSPrecomA (GTCTGATACCTCCGAAGAGCTCAC), DMP1recomA (GTTAGGTTGCTGTGTAATACTGGC). Fluorescent protein antisense primers were: CT genotype (GTTTACGTCGCCGTCCAGCTCGACCAGGAT) for ECFP and Topaz fluorescent proteins and mCherry genotype (GCACCTTGAAGCGCATGAACTCCTTGATGA) for mCherry fluorescent protein. The rest of the bacteria culture was grown to confluence and minipreps were carried out. BAC clones were digested with Sal I to verify integration of pLD53 vector (pLD53 introduces a SalI site). Two positive integrants as determined by colony pcr and FIGE were further processed for backbone resolution. Two colonies from each clone were picked from the original re-streaked plate and grown for one hour with shaking in LB media without ampicillin, but in the presence of gentamicin or spectinomycin. 10–100 ul of media was spread onto TG plates and grown overnight at 37c. 40 colonies were picked and replated onto LB plates containing the appropriate antibiotic (no amplicillin). To enrich for resolved clones gentamicin/ampicillin or spectinomycin/ampicillin plates were also used as a replica of the 40 clones. Small colonies were favored over larger colonies when picking clones. Twenty ampicillin sensitive colonies were grown initially screened by colony PCR to verify the presence of the fluorescent protein reporter. Diagnostic restriction digests and FIGE was further carried to verify the genomic integrity of the clones and confirm pLD53 backbone resolution. Moreover, primers flanking the B homology arm were also used in combination with recomBoxA oligos to confirm resolution: TRAPrecomB (CATAATCTGTCCTCTGGCCTG), IBSPrecomB (GAACAGCTGGCTGACAGCACTGAATCAAC), DMP1recomB (TCCAGTTACACCACATAG GAATTG).

Linking Genes of Interest

The bacteriophage Red recombinase system was introduced into BACLink-SP containing DMP1-mCherry and IBSP-Topaz reporter genes by transformation of mini lamda and bacteria cells were made electrocompetent as described above. 10 ug of BACLink-GM TRAP-ECFP was digested with I-PPO1, phenol/cholorform extracted, precipitated, and resuspended in TE. 2 ug of digested BAC was transformed into competent bacteria containing SP-DMP1mCherry/IBSP-Topaz. Transformed colonies were selected for on LB gentamicin plates (5 ug/ml). Clones were initially screen by PCR using primers BL-TRAP (ACAGATTTGTGAGATAGTCACACAATTC) and BL-DMP1 (GACAATGTTTGCAGACTATGAATGAAG) that flank the linked genomic region. PCR positive clones were further verified by diagnostic restriction digest.

Generation of Transgenic Animals

The linked BAC construct was purified from 250 mls of bacteria culture using a large construct kit (Qiagen). 10 ug of BAC was linearized with I-PPO1 restriction enzyme for 2 hours and was further purified on a CL-4B sepharose (Sigma) column that was pre-equilibrated with injection buffer (10 mM Tris pH7.5, 0.1 mM EDTA, 100 mM NaCl). Twelve 200 ul fractions were collected and BAC DNA was quantified using a pico green DNA assay (Molecular Probes) and/or using a Nanodrop spectrophotometer (Thermoscientific). Pronuclear injection was carried out at the UCONN Health Center Gene Targeting and Transgenic Facility (GTTF).

Preliminary Transgenic Characterization

For imaging of transgene expression in spine, 6 week old females were sacrificed in accordance with our animal care protocols and tissues were dissected and fixed in 4% paraformaldehyde for 4 days, decalcified in 28% sodium free EDTA for 5 days, immersed in 30% sucrose/1 mM MgCl2 for 1 day. Decalcified tissue was frozen embedded and cryosectioned on to cryofilm type IIC tape (Finetec). Sections were imaged on a Zeiss Z.1 Observer inverted microscope. Filter sets used for imaging were purchased from Chroma Technology and are as follows: (HQ500/20 Ex, HQ 535/30 Em, Q515lp beam splitter) for Topaz (YFP), (D436/20 Ex, D480/40 Em, Q455dclp beam splitter) for ECFP, (HQ577/20 Ex, HQ640/40 Em, Q595lp beam splitter) for mCherry. TRAP staining was carried out after imaging bone sections with for ECFP using the Acid Phosphatase Kit (Sigma).

Estimating Transgene Copy Number

Tails were clipped from three animals of each mouse line and wild type animals. Genomic DNA was prepared using a DNAeasy Blood and Tissue Kit (Qiagen) and real time PCR was carried out on an I-Cycler (Biorad) for the Trap gene 5'TRAP (GTCTGTGGAACTGACGGCTGTAGATGGCTA) 3'TRAP (AGTGGCGGCCGCCCATGAATCCATCTGTGAGGAAGAGAG) and normalized to the Biglycan gene 5'-Biglycan (CAGAGCTTACACCCACTAACATACTC) 3'-Biglycan (CTCCGAAGCCCATAGGACAGAAGTCA).

Fold difference of transgenic mouse lines was compared to wild type CD1 mice and transgene copy number was estimated based on this fold difference.