Información

¿Qué sucede si inyectamos enzimas de restricción en la sangre?

¿Qué sucede si inyectamos enzimas de restricción en la sangre?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Solo una pregunta curiosa, si extraemos la enzima de restricción y la inyectamos en nuestro cuerpo, ¿qué pasa?

  • ¿El anticuerpo lo reconoce y lo bloquea?
  • ¿Puede la enzima de restricción atravesar la membrana celular y destruir el ADN de una célula viva?

La aparición de cualquier antígeno extraño (p. Ej., Proteínas como las enzimas de restricción entran en esta categoría) en el sistema circulatorio debería desencadenar una respuesta inmunitaria.

En realidad, existen dos barreras de membrana que las enzimas tienen que atravesar para acceder al genoma nuclear: la membrana celular y la membrana nuclear. Las proteínas suelen ser demasiado grandes y demasiado cargadas para cruzar una membrana de bicapa lipídica, a menos que haya un poro (como en la membrana nuclear) o un receptor para la proteína en la superficie celular.

Cuando las células se diseñan para expresar enzimas de restricción extrañas usando transgenes, entonces sí, si la proteína puede ingresar al núcleo, la enzima comenzará a digerir todos sus sitios de reconocimiento.

Jasper Rine demostró esto para la levadura de panadería S. cerevisiae en 1986.


Descubrimiento de enzimas de restricción

Descarga el video de iTunes U o del Archivo de Internet.

Bien, me gustaría pasar ahora al siguiente segmento del curso.

Creo que probablemente puedas apreciar un poco mejor este triángulo que tenía antes sobre cómo lo que hicieron los bioquímicos fue que tendían a abrir las células, mirar los componentes, a través de otras cosas allí y luego las proteínas.

Pero una gran cantidad de cosas que tienen que ver con la función son las proteínas, y lo que harían los genetistas, la disciplina de la genética, que hizo mutantes de organismos vivos, y que analizó cómo la función se ve afectada por la mutación de genes individuales, cómo ambos eran muy enfoques poderosos. La genética te dijo lo que era realmente importante y la bioquímica te dijo cómo funcionaba a nivel molecular, pero el problema real es saber si esa cosa que tenías haciendo algo en el tubo de ensayo fue realmente la que lo hizo en la vida.

Y creo que servirá cuando Arthur Kornberg aisló la primera ADN polimerasa, pudo copiar ADN. Y obtuvo un premio Nobel, y fue la primera enzima que pudo copiar el ADN, y luego John Karens creó un mutante al que le faltaba la enzima. Y el organismo aún estaba vivo.

Por lo tanto, no podría haber sido la ADN polimerasa la que copiaba el cromosoma. De hecho, resultó ser una enzima reparadora del ADN. Entonces, si realmente puede unir la genética y la bioquímica, si puede tomar un mutante que está roto en una función y descubrió que faltaba su proteína, o viceversa, entonces tuvo una visión muy, muy poderosa porque conecta su conocimiento de lo que era fisiológicamente importante para la bioquímica que estás haciendo. Pero fue realmente, muy difícil durante años, y solo en muy raras ocasiones algunos genetistas tuvieron un mutante que sugiere tan fuertemente que algunos bioquímicos buscarían, o algunos bioquímicos tendrían un resultado tan poderoso que hablaron con un genetista y vieron si nadie había encontrado el resultado.

Y el poder del ADN recombinante, aunque inició una industria biotecnológica e hizo posible la secuenciación del genoma, hay otro nivel superior en la comprensión conceptual.

Y lo que hizo fue que te permitió ir y venir entre aquí y aquí.

No tendrías ningún problema ahora si te di la secuenciación del gen, puedes encargarlo. Podría introducirlo en una célula y producir cantidades masivas de proteína. Lo purificaste veinte veces y sería puro, mientras que antes podrías haber tenido que purificarlo quince mil veces de 1000 g de células, y hubieras tenido que ser un muy buen bioquímico con 15 pasos para purificar. eso. Entonces, puede pasar de la secuencia del gen a la proteína, o si obtuviéramos una proteína y quisiéramos saber qué gen simplemente secuenciaríamos un poco de la proteína, usaríamos ese código genético, trabajaríamos hacia atrás hasta algunos posibles. secuencias, luego busque las secuencias y luego busque el gen. Entonces, lo que el ADN recombinante nos permite hacer es cerrar ese ciclo. Puede pasar de la genética a la bioquímica de ida y vuelta. Ahora todo el mundo hace de todo en lugar de ser disciplinas aisladas, que era cuando entré al campo. Entonces, todo el material dependía del desarrollo para clonar piezas particulares de ADN.

Y quiero dejar en claro desde el principio, hay un par de usos de la clonación que son de uso popular en este momento. De lo que estamos hablando en esta conferencia es de la clonación de un fragmento de ADN. Lo que eso significa es que voy a tomar un segmento particular de ADN, digamos, cortarlo aquí y cortarlo allí.

Y voy a tomar esa pieza, y voy a hacer algo que me permita amplificarla y hacer muchas, muchas copias de esa pieza de ADN. Y clonando cualquier otra cosa, haces un montón de copias.

Así que ese es uno de los usos de la palabra clonación.

El otro uso, que se ve en la prensa popular todo el tiempo, es clonar a un individuo, pero al no estar ahí, se toma el núcleo de la célula del individuo, él pone ese núcleo en un huevo que no tiene su Su propio núcleo se movió, y ahora espera que lo que obtenga de él sea un organismo que tenga el mismo contenido genético que el individuo inicial.

Y de hecho, aunque suena muy bien en papel, es probable que esté empezando a ver que no es la panacea que la gente pensó que era, o que tendríamos que preocuparnos de que en 10 años, todos mis estudiantes del MIT serían clones de la persona más brillante de la clase o algo así, porque suceden otras cosas, porque a menos que vayas a cursos avanzados de biología, hay modificaciones de ADN. Le suceden todo tipo de cosas, por lo que no es idéntico.

Y muchos de estos organismos clonados, como la oveja Dolly, que era famosa, murieron temprano, lo olvido, con artritis y cosas así. Entonces, hay muchos problemas en ese aspecto. Pero ese es el otro uso de la palabra clonación y eso no es lo que se trata en las próximas tres conferencias de las que estamos hablando sobre la clonación de un fragmento de ADN. Y ese fue el gran problema que enfrentó el campo, ciertamente cuando yo era un estudiante de pregrado e incluso cuando era un estudiante de posgrado estaba interesado en sintetizar fragmentos de ADN, y fue una de esas cosas que la gente decía, ¿por qué lo estás haciendo? ? Bueno, porque podrías intentar hacerlo. ¿Qué pasa si tienes un fragmento de ADN, como Gobind Khorana, que es mi colega, que recibió el premio Nobel por sintetizar el primer gen?

Lo sintetizó. Era un gen de ARNt que tenía 120 pares de bases de nucleótidos de longitud o algo así. Lo sintetizó.

Le había demostrado que podía hacerlo. Pero no pudiste hacer nada con eso.

Y hubo dos grandes problemas. Uno fue el hecho de que este ADN, aunque no es un tetranucleótido monótono.

Es bastante difícil de decir. Cada una de estas cosas es un par de bases, y el ADN humano tiene 3 mil millones de esas. Y un poco aquí abajo, no se ve muy diferente a lo que hay afuera.

Y ciertamente no se vería muy diferente al fragmento de ADN que tiene 2 mil millones de pares de bases al otro lado del campus o algo así. Entonces, no hay forma de tomar ADN y cortarlo de manera reproducible, por lo que se obtienen fragmentos.

Lo que se podía ver en los primeros principios era que lo que se necesitaba eran unas tijeras mágicas. ¿Y cómo serían las tijeras? Bueno, tendrían que ser unas tijeras que pudieran secuenciarse porque no hay nada más diferente. Sabes que es una columna vertebral normal y solo tiene cuatro nucleótidos. Entonces, si querías cortar ADN en lugares particulares, tenías que tener tijeras que pudieran ver una secuencia.

Y además, puede ver que no podrían simplemente, están las partes de enlaces de hidrógeno de ANT o GNC porque están pegadas allí en el medio del ADN.

Entonces, necesitarías tijeras que de alguna manera pudieran encontrar una secuencia y hacer un corte. Y esos fueron encontrados. Voy a hablarte sobre eso.

Se llaman enzimas de restricción. Así que eso era parte del asunto. La otra cosa era, imagina que podría cortar este fragmento. Y te lo dieron, y yo dije, genial. Ahora lo tengo.

¿Me harías muchas copias de este ADN?

¿Podrías hacer eso? Digamos que ahora sabe cómo transformar el principio que vimos con Avery.

Podríamos tomar ADN desnudo y poner este fragmento en la célula.

¿Se replicaría? ¿Qué piensas? ¿Alguien recuerda?

¿No? OK, hablamos de otros idiomas, ¿verdad?

Pero una de las cosas que está en el ADN es el código genético con todos los genes. Y podemos encontrar el marco de lectura. Recuerda cuando hablamos sobre el origen de la replicación. Dije que era una especie de, al menos para E. coli hay un origen. En eucariotas, los orígenes están espaciados a lo largo del ADN. Y cada vez que tienes una ronda de replicación, comienza con uno de esos orígenes y luego continúa.

Entonces, la probabilidad de que este fragmento de ADN por casualidad tenga un origen es bastante pequeña. Entonces, si lo pongo en un organismo, se quedará allí, si tienes suerte, lo degradará porque tiene [¿mezclas? , o incluso si lo hiciera en círculo, probablemente no se replicaría porque probablemente no tiene la palabra en el ADN que dice comenzar una ronda de replicación del ADN.

Entonces, el otro principio general de la replicación del ADN es que de alguna manera tiene que tomar el fragmento de ADN que está mirando y debe adjuntarlo a un origen de replicación.

Ahora, si tienes un origen de replicación y tienes un fragmento de ADN, y lo pones en la célula, obtendrás muchas copias de ese fragmento de ADN. Así que de eso se trata el ADN recombinante en una forma realmente, realmente simple. Solo voy a llevarlos ahora a niveles de detalle cada vez mayores.

Entonces, permítanme darles una especie de visión muy amplia de esta clonación, y luego comenzaremos a sumergirnos en algunas de las técnicas más sofisticadas que han surgido de esto.

Hablaremos de secuenciación de ADN, PCR y otras cosas en la próxima conferencia. Entonces, el primer principio aquí es cortar el ADN, y sé que puede pensar que esto es una especie de charla infantil, pero así es como yo pienso. Si realmente piensas en estas cosas, esto es lo que realmente es. Con tijeras moleculares de secuencia específica, estas tienen un nombre bastante extraño.

Se llaman enzimas de restricción. No sé si alguno de ustedes sabe por qué se llaman enzimas de restricción, y aunque estoy seguro de que algunos de ustedes las han usado en su operación para cortar fragmentos de ADN.

Pero lo que eso hace, son enzimas, como les diré, que reconocen una secuencia en particular. Y siempre cortan en esa secuencia. El valor de eso es que puede cortar ADN de manera reproducible exactamente en el mismo lugar, y los puntos se especifican por cualquier secuencia que ese par de tijeras en particular sepa leer.

Entonces, lo siguiente que tenemos que hacer es unir el fragmento de ADN a un origen de replicación. Entonces, lo que lleva el origen de la replicación se llama vector. Y por lo general, no siempre, se trata de círculos. Consideraremos que los que crecen en E. coli son la mayor parte del tiempo, o en bacterias, en su mayoría círculos.

Son los que se utilizan ampliamente para la mayoría de clonaciones.

Entonces, hablaremos de esos. ¿Qué hace un vector? Cuando tiene que tener es un origen de replicación del ADN. Suelen tener algo más. Podríamos llamarlo un marcador seleccionable, pero algo así como una resistencia a los medicamentos.

Si alguno de ustedes ha clonado en un UROP, por lo general es algo así como un gen para hacer que la célula sea resistente a la ampicilina, o resistente a la tetraciclina, un antibiótico que normalmente mataría la célula.

Entonces puede decir si esa célula tiene ese vector o no porque la célula comienza en cualquiera de los dos sensibles a la ampicilina.

Adquiere el vector que lo está replicando, también adquiere el gen que le da la resistencia al fármaco.

Pero si vamos a cortar eso, si vamos a unir un trozo de ADN a eso, no podemos unirnos en un círculo sin romperlo.

Entonces, necesitamos cortar el vector en un sitio único. Y usaríamos una enzima de restricción para eso. Y también puede ver al diseñar un vector, querría algo que solo tenga un sitio.

Entonces, lo que hubiéramos logrado a partir de esto conceptualmente como ahora lo tenemos, este es el vector, su origen de replicación aquí, y digamos resistencia a la ampicilina, por ejemplo, como un marcador seleccionable, el gen para eso podría estar codificado. aquí. Y tenemos el fragmento de, si quieres, déjalo en el suelo, creo. Hemos aclarado el punto en esta etapa. Gracias.

Lo que hay que hacer es unir este fragmento de ADN a eso.

Y vamos a ir a los detalles moleculares de esto.

Pero, uniremos el fragmento al vector, y en realidad esto era algo que ya estaba en las cajas de herramientas de los biólogos moleculares, hemos estado estudiando la replicación del ADN. Eso es ADN ligasa.

Cuando terminamos un fragmento de Okazaki, tuvimos que sellar [ININTELIGIBLE] y la enzima que lo hizo fue una enzima llamada ADN ligasa.

Entonces, los biólogos moleculares básicamente tenían la cinta adhesiva o el pegamento para unir las cosas. Lo que les faltaba durante muchos, muchos años era la secuencia específica de las tijeras moleculares.

Entonces, en esta etapa, si estuviéramos haciendo el ADN recombinante, ahora tenemos un vector. Ahora tenemos un trozo de ADN unido a él. De hecho, probablemente tengamos un lío completamente diferente de cosas que suceden en el camino.

Pero por el momento, están en un tubo de ensayo.

Entonces, si queremos que esto crezca, ¿qué tenemos que hacer a continuación?

Tendremos que obtener el ADN del exterior de la célula dentro de la célula. Esa es la palabra que necesitamos para transformar el ADN en una célula.

Nuevamente, la palabra transformar, que se remonta a esos experimentos de transformación con la neumonía por Streptococcus pasando de suave a rugosa, y estás tomando cosas de la célula que las transformó de rugoso a suave, lo que sea, de ahí vino la palabra, pero nosotros ahora sabemos que está obteniendo ADN desnudo dentro de la célula donde se puede replicar.

Y luego, lo siguiente que necesitamos saber es qué células han adquirido este vector que al menos como vector.

Nos conformaremos con eso al principio, y para hacer eso, debe seleccionar el marcador en el vector. En el caso de este, comenzaríamos con una cepa que mató mi ampicilina, y luego simplemente lo jugamos y preguntamos por tipos que sean resistentes a la ampicilina. Y pueden ver que hay otra clase de problema porque si tuviéramos un vector sin cortar, y probablemente habría algo de eso en nuestra mezcla, eso haría que las células fueran ampicilina. Y si tuviéramos un inserto, también sería ampicilina. Entonces, si realmente quisiéramos entrar en esto, tendríamos que trabajar un poco más para resolver lo que hay allí.

Pero eso es lo básico. Sospecho que la mayoría de ustedes saben esto prácticamente desde el jardín de infancia. Pero ese es el marco general en el que, ahora, comenzaré a colocar diferentes detalles en capas. Y la siguiente parte, nuevamente, algunos de ustedes pueden saber. No creo que sea un concepto totalmente ajeno. Probablemente esté familiarizado con esto, ¿qué son estas enzimas de restricción? La palabra real es endonucleasa de restricción. A menudo se les llama enzimas de restricción en un laboratorio [¿parlons?]. La nucleasa es algo que corta el ácido nucleico y la endonucleasa es una que no necesita un extremo libre. Por lo tanto, puede cortar a la mitad de la secuencia en lugar de mordisquear al final. Eso sería una exonucleasa. Entonces, estas cosas tienen nombres que tienden a ser algo así como ECO-R1, que tiene algo que ver con el lugar de donde se derivan. Y uno típico, uno de los primeros que todavía se usa mucho, es ECO-R1.

Y este reconoce la secuencia G A A T T C.

Ahora, notarás que si lees la secuencia de esta manera, es la misma secuencia cuando la lees en la otra hebra.

Se llama palíndromo, pero ten cuidado porque palíndromos en inglés, esas son palabras que lees de adelante hacia atrás y son iguales. En una letra inglesa, no importa si está en A aquí o en A allá.

Pero ustedes saben algo sobre la estructura del ADN.

Hay una polaridad primaria de cinco a tres. Entonces, leer de esta manera no se ve igual. Es totalmente diferente.

Pero leyendo en esta línea, decimos que son cinco a tres.

Lo que es idéntico es la secuencia recíproca del otro lado. Entonces hay esto, ves G A A y G A A pero no es como la palabra inglesa palíndromo, así que confúndete con eso.

De todos modos, lo que esto hará entonces, lo que hará esta enzima, es cortar hacia un lado aquí. Corta simétricamente.

Y lo que los genera es un hidroxilo G tres prima.

¿Recuerdas la ribosa? Si tenemos, digamos, una A allí, esta es la posición principal tres, y esa es la posición principal cinco en el azúcar. Entonces, deja un hidroxilo de tres primos, y luego también deja un fosfato de cinco primos.

Entonces, tendríamos A A T T C aquí, y luego, en el otro lado, obtendríamos lo recíproco. Entonces, tendríamos G con un hidroxilo de tres primos, y luego sobre A A T T C así.

Así que ahora tenemos un descanso aquí. Podemos separarlos. Pero una de las cosas buenas que puedes ver a partir de esto es que estamos generando cinco extremos primarios de una sola hebra, y esta es la secuencia AATT C. Esto es AATTC aquí, y estos tipos, si pudieran juntarse y alinearse como lo harían aquí, podrían formar enlaces de hidrógeno. Entonces, si tomas una enzima como ECO-R1, y tomamos, digamos, un círculo que tiene un solo sitio ECO-R1, G A A T T C, si lo cortamos con la enzima de restricción haríamos [¿mellas?]. Y si mantuviéramos un resfriado, todo lo que tendríamos son mellas en el ADN. Y si calentamos un poco las cosas, solo hay cuatro enlaces de hidrógeno que lo mantienen unido.

Entonces, la cosa se linealizaría y simplemente flotaría con la brisa.

Si lo enfriamos lentamente, el estado termodinámicamente más favorable, el estado de menor energía, sería con esos extremos volviendo a estar juntos. Entonces, podríamos agregar ADN ligasa.

Si sumamos estos y agregamos ADN ligasa, podríamos revertir el proceso e ir y venir, ECO-R1 para cortarlo, ADN para ligarlo.

Y luego, la belleza del ADN recombinante es que esta parte que se reincorpora no ve lo que hay aquí o lo que hay afuera.

Todo lo que ve son los pequeños extremos que genera un sitio ECO-R1.

Así que toman parte de mi ADN y lo cortaré.

Obtendré un trillón de fragmentos ECO-R1, pero todos tendrán la misma pequeña parte que sobresale que es complementaria al vector.

Entonces, si tomo un corte de vector con ECO-R1, y tomo parte de mi propio ADN y los mezclo, puedo obtener un pequeño fragmento, meterme entre el vector y hace exactamente esa unión que estaba diagramando aquí mismo. . De nuevo, fue el descubrimiento de estas enzimas de restricción lo que hizo posible casi todo lo que ha sucedido en biología desde 1975. El desarrollo de las enzimas de restricción fue esencialmente, yo era un postdoctorado en Berkeley en ese momento y los laboratorios, Stan Cohen en Stanford , Herb Boyer de UCSF y otros dos en todo el país estaban trabajando en esto.Casi todos eran laboratorios que habían trabajado con plásmidos bacterianos. Los plásmidos son pequeños círculos de ADN, por lo que los laboratorios que comenzaron fueron los que han estado ocupados estudiando pequeños círculos de ADN que generalmente llevan resistencias a los fármacos entre las células.

Y eso estaba sucediendo mientras yo era un postdoctorado.

Y cuando llegué al MIT en el 76, la tecnología apenas comenzaba.

Fui uno de los primeros laboratorios que intentó cortar trozos de ADN y volver a unirlos. Entonces, es un desarrollo bastante reciente.

En ese momento, la secuenciación del ADN no se había inventado.

La idea de que se pudiera extraer un fragmento de ADN y hacer algo con él o producir una proteína era solo una idea. No existía.

Por lo tanto, es difícil enfatizar demasiado lo crítico que fue el descubrimiento de estas enzimas de restricción. Ahora, solo quiero decirles de dónde vinieron o cómo la gente los encontró.

Y tratarán de hacer esto rápidamente porque sé que algunos de ustedes se impacientan con la historia. Pero esto es realmente importante porque es muy fácil burlarse de la investigación básica. Puedes ridiculizar cualquier cosa con bastante facilidad, y podrías preguntar porque te estoy contando la historia. Alguien propuso hacer esto.

Les voy a contar el experimento que básicamente es la base de la industria biotecnológica, y ¿hubieran sido lo suficientemente inteligentes como para reconocer que fue el descubrimiento de un fenómeno llamado restricción, restricción en el crecimiento de bacteriófagos en bacterias?

Y lo fue, aquí hay un par de EM y estos pequeños plásmidos. Esta es una micrografía electrónica.

En estos pequeños círculos ha sido ensombrecido. Y esto en realidad está coloreado artificialmente, pero ese era el tipo de plásmidos que la gente estaba cortando. Entonces, como dije, tratando de atravesar este ADN y todo eso, lo que hizo posible la secuenciación en el Whitehead Genome Center y las cosas de las que les contaré está sucediendo. Realmente no configuré este.

Pero ese es Eric Lander, quien enseña 701 en otoño.

Te dije una foto de ese ADN 50. Bueno, tuvieron un banquete al final y yo estaba allí.

¿Este es [Savandi Pabo? de Europa que está secuenciando el genoma del chimpancé. Y ese es Francis Collins, quien dirige todo el Proyecto Genoma Humano. Esta es Evelyn Witkin, quien fue una gran descubridora de los primeros eventos de reparación del ADN.

Y lo puse porque era bastante interesante.

Allí estaban Eric y Savandi, y Francis estaban hablando de lo que sucedería cuando supieran la secuencia del genoma del chimpancé, lo que no se hizo. Y había un anuncio, un cartel que anunciaba el último libro de Jim Watson. Y lo partieron por la mitad, y estuvieron escribiendo notas en la parte de atrás durante toda la cena.

Entonces, si desea ver cómo se ven los científicos en la vanguardia, incluido alguien que enseña 701 el otoño cuando no están enseñando 701, hay una imagen.

De todos modos, el descubrimiento de las enzimas de restricción fue Salvador Luria, a quien he mencionado. Fue miembro del departamento de biología y uno de nuestros ganadores del Premio Nobel.

Comenzó el centro de cáncer. También entrenó en Jim Watson, cuando les mostré esa foto. Este es Salvador parado aquí.

Otra cosa que hizo Salvador, fue premio Nobel pero pensó en biología introductoria. Así que básicamente sigo los pasos de Salvador. Escribió un libro llamado, a pesar de ser ganador del Premio Nobel, un libro llamado 36 conferencias en biología introductoria. Y en algunas universidades, la introducción a la biología la enseña quien está en la parte inferior de la cadena alimentaria. El profesor más joven se queda atascado con la introducción a la biología.

Y aquí es al revés. Quiero decir que vas a conseguir que Eric y Bob, por ejemplo, Weinberg enseñen en el otoño, te lo dice.

Y realmente de dónde viene eso es el hecho de que Salvador Luria tenía tanto interés en la replicación. Entonces se formó en Jim Watson, abrió el centro de cáncer aquí y también llevó a cabo este fenómeno de restricción. Y hacer que esto funcione con bacteriófagos. ¿Y conozco a una [pareja que escribió?

, no le gustaba ver a los viejos en los porches. Así que me asusté y saqué la siguiente foto para esta mañana. Oh, tengo que mostrarlo de todos modos por dos razones. Este es Salvador sentado en un porche en Cold Spring Harbor con Max Delbrook, quien realmente comenzó gran parte del trabajo sobre bacteriófagos que nos dio las bases de la microbiología. Y luego ponerlo en parte en A porque muestra la informalidad de la cultura de la biología molecular que persiste hasta el día de hoy, y también porque Salvador tenía un sentido del humor tan travieso. Habría disfrutado mucho si él hubiera estado enseñando este curso. De todos modos, Salvador estaba estudiando este bacteriófago. ¿Recuerdas que hablamos de eso?

¿Y básicamente [con jeringa? inyectaron su ADN en la célula. Hay una micrografía electrónica. El ADN está arriba.

Entra y luego el ADN se apodera de la célula, la reprograma y produce babyphage. Y les mostré cómo hacemos placas.

Así que eso era lo que estaba estudiando Salvador. Y es un poco como lo que estamos hablando con Mendel. No tenía muchas técnicas disponibles para él en ese momento. No pudo secuenciar el ADN.

No podía hacer muchas cosas. Pero él podría [platear fagos?

y contar, y cosas así. Y lo que Salvador estaba mirando, tenía un bacteriófago y tenía dos cepas de bacterias.

Los llamaré A y B. Bien, aquí viene el experimento que fundó la industria biotecnológica. ¿Estás listo? ¿Me vas a financiar?

Muy bien, lo que propongo hacer es cultivar el fago en la cepa A, y ahora voy a plaquear en la cepa A y la cepa B.

Me quedé despierto toda la semana pasada pensando en este experimento.

Entonces, ¿qué obtuve? Tengo muchas placas en la cepa A, probablemente algo así como 109 o 1010 por mil porque así es como suele verse este lisado de fagos una vez que los has hecho crecer.

Y si los coloco sobre la cepa B, no hay fagos, tal vez un fago ocasional. Entonces, el bacteriófago erizado puede hacer crecer el mío en la cepa A. No puede crecer en la cepa B la mayor parte del tiempo, pero alguna variante ha logrado descubrir cómo crecer en la cepa B. Dar nuestra incursión en la genética, creo que muchas de ustedes pensarían, probablemente como sospecho que hizo Salvador en ese momento, las cosas mutaron. Se aprende. Hizo algún cambio en sus genomas que le permitió crecer en la cepa B. Entonces, me pregunto si aprendió a crecer en la cepa B, ¿no podría crecer en la cepa A? Entonces, básicamente lo que tomó fue el fago de ese experimento, y luego los colocó en la cepa A y la cepa B. de placas por aquí. De acuerdo, no se olvidó de cómo cultivar en la cepa A. Entonces, mejor revise aquí también, necesito un experimento de control, así que tome a este tipo, colóquelo en una placa, cepa A, cepa B, algunas placas por aquí.

Eso no es una sorpresa en la cepa A.

Volvemos al punto de partida. No suena como un mutante, ¿verdad? Y si fuera un mutante, todos deberían haber sido iguales.

En cambio, cuando cultivó un fago en la cepa A, no tenía la capacidad de crecer en la cepa B. Pero si le dieras la oportunidad de crecer en la cepa B, la mayoría de ellos no lo lograría.

Pero si alguna vez lo hizo, ahora había adquirido la capacidad de crecer en la cepa B. De modo que aún podría crecer en ambas.

Pero si se toma a alguien que había estado creciendo, algo había estado creciendo en la cepa A, lo perdió. Y entonces, surgió la idea de que no se trataba de una mutación. Algo estaba sucediendo en la cepa B que le permitió crecer en la cepa B.

Y si alguna vez se alejó de ese entorno, [¿él?

lo perdí. Entonces, el fenómeno se llamó restricción.

No fue una mutación. Era algo más.

Y resultó, entonces, que la restricción se debía a una enzima. Un ejemplo de este tipo de cosas, entonces, sería esta actividad ECO-R1 que es capaz de cortar en una secuencia muy específica. Ahora, si va a tener un juego de tijeras moleculares dentro de usted que podría cortar una secuencia G A T C, tendría un problema a menos que hiciera algo más porque cada una de sus secuencias G A T C sería cortada por las enzimas de restricción.

Entonces, qué tienen las células que tienen una enzima de restricción, como una enzima de modificación que reconoce la misma secuencia y luego la modifica de alguna manera que la hace resistente a la enzima de restricción. Y en el caso del ECO-R1, pone un grupo metilo en este A. Es posible que haya pensado que eso interferiría con el emparejamiento de bases, pero no es así porque la adenina se ve así. Estos son los tipos que hacen el refinamiento de pares de bases, si miras hacia atrás, verás que podrías poner un grupo metilo allí. No interferiría con el emparejamiento de bases, pero permitiría que esto suceda. Entonces, fue el descubrimiento de este fenómeno de restricción de bacteriófagos que crecieron en una cepa, no en otra. Podría aprender a crecer en la otra cepa.

Podría perder esa adquisición. Fue ese fenómeno. La gente, no tenía otra razón que no fuera un problema interesante en biología para entenderlo. Una vez que entendieron la base de esto, se abrió otro mundo entero porque se podía ver a partir de los principios básicos, ahora podía cortar cualquier trozo de ADN. Podría generar estos pequeños extremos pegajosos que sobresalen. Podría tomar un plásmido.

La gente los conocía. Pude encontrar uno que solo tenga un sitio de restricción. Podría meter cosas.

Ahora he adjuntado un origen de replicación a cada una de esas piezas.

Y estoy en el negocio. Ahora puedo, por primera vez, tomar un fragmento particular de ADN y hacer tantas copias como quiera.

Y esa fue una transformación absoluta en la forma en que las personas podían pensar sobre la biología. Así que les voy a dar una idea de cómo empezaría la gente. Entonces, la forma en que la gente comenzó y aún comenzó la mayoría de las cosas es que lo llamarían, el término habitual es la construcción de una biblioteca de ADN recombinante.

Y hay una variedad de formas diferentes de hacer esto.

Pero este principio es el mismo. Tomamos el ADN de cualquier organismo que le interese, [¿y estudiando?].

Y cortamos con alguna enzima de restricción. Y esta enzima de restricción cortará dondequiera que haya sitios. Pueden estar muy juntos. Pueden estar muy separados. Pero sea lo que sea, todavía genera algún conjunto característico de fragmentos. Y ahora tendremos, en este caso, el fragmento número uno, el fragmento número dos, el fragmento número tres, el fragmento número cuatro, y así sucesivamente. Y si es mi ADN, hay muchos fragmentos. Y, por supuesto, están todos mezclados.

No sé dónde está ninguno de ellos. Están todos mezclados en el tubo de ensayo. Luego tomaremos ese vector que hemos abierto. Y ahora, mezclaremos todos estos fragmentos junto con este vector. Y luego lo unimos de la misma manera [¿en que está cortado? . Y ahora lo que obtendremos, es una colección de plásmidos que tienen diferentes inserciones.

Entonces, uno de los plásmidos tendrá ese fragmento número uno.

Otro de ellos tendrá el fragmento número dos, número tres, y así sucesivamente. Entonces todo esto es lo que se conoce como biblioteca. Puedes ver si es ADN mío, había 3 mil millones de pares de bases para comenzar. Dado el ADN humano, las secuencias G A T C son bastante comunes. Puede calcular la frecuencia usted mismo para cuántos sitios en promedio habría para una enzima de restricción dentro de un fragmento de ADN y calcular aproximadamente cómo estarían los fragmentos en la biblioteca de ADN humano.

Entonces, estamos a mitad de camino. Ahora podemos hacer una biblioteca.

Podemos hacerlo a partir de ADN bacteriano. Podemos hacerlo a partir de ADN humano. Pero lo siguiente que la gente tuvo que aprender a hacer fue averiguar cómo encontrar un fragmento en particular que tuviera el gen que le interesaba. Y hay una gran variedad de cosas. Quiero decir, en última instancia, hoy desde que se secuencia el genoma humano, vas a una computadora y un tipo y lo encuentras porque la secuencia es conocida. Pero la única razón por la que podemos hacerlo es por todo el trabajo que se hizo en el medio.

Entonces, te daré varias formas de hacer esto. Pero una de las formas en que creo que se puede ver muy fácilmente, y en realidad es volver al término complementación. ¿Recuerdas la complementación?

Teníamos algo que era mutante, y luego le pusimos un gen de tipo salvaje y lo arreglamos de nuevo. Entonces, por ejemplo, supongamos que estoy estudiando la biosíntesis de histidina en E.

coli, y quería encontrar el gen que codificaba la enzima que acababa de deshabilitar en mi histidina menos mutante. Entonces, si tengo un [¿hisoxotrofo?], Lo llamaré [¿su G?

gen, por ejemplo, es uno de los genes involucrados en la producción de histidina. Entonces, dado que es un auxótrofo de histidina, si lo tengo en placas de glucosa mínimas y lo extiendo, no va a crecer. Pero si lo cultivo con un mínimo de glucosa más histidina, entonces podrá crecer, ¿verdad? Entonces, tengo una variante de este organismo.

Tiene una sola mutación que afecta a un gen.

Y como no tengo ese gen, no puedo crecer al mínimo.

Si hice una biblioteca de ADN de E. coli, que también tendrá muchos fragmentos, y tomé esa biblioteca y la puse en este mutante, obtendré un gran lío de cosas, todas las diferentes plásmidos con todos los diferentes fragmentos que entran en ese mutante. ¿Cómo voy a encontrar el que quiero? ¿Alguien vio eso? No es tan dificil. Soy el mutante.

No puedo crecer al mínimo porque no puedo producir esta enzima.

Por lo tanto, no puedo producir histidina. ¿Qué necesito? ¿Cómo podrías arreglarme si fueras médico? ¿Cuál es el gen que queremos que salga de aquí?

El que produce esa enzima en particular que produce histidina.

Sí, toma toda la biblioteca, métela en este mutante. Si el gen que ingresa codifica la ADN polimerasa, no voy a ayudar a este tipo. Todavía no crecerá al mínimo, ayudaría tomar un gen involucrado en hacer parte de la pared celular.

Pero si pongo el, obtengo un fragmento de ADN que incluye su gen G plus, y lo pongo aquí, va a crecer. Si tiene el plásmido que tiene, o digamos el vector que tiene su gen G plus.

Entonces, lo que han hecho es, en cierto modo, que han utilizado ese principio de complementación que algunos de ustedes se estaban preguntando cuando estábamos haciendo genética. Entonces, romperías una copia de un gen.

En las cosas de las que hablamos, incorporamos un cromosoma completo que incluía solo una copia de tipo salvaje del gen. Con el ADN recombinante, realmente podemos reducirlo al extremo. Podemos traer un fragmento de ADN que es solo el gen que está roto.

Y podemos llevar el gen al tipo salvaje. Una cosa, solo para cerrar, verán, si recuerdan cuando hablé de lenguajes que no son universales, aunque el código genético es universal, los promotores y las cosas no lo son. Así que nunca podría hacer esto con un ADN humano, ¿verdad ?, porque no se expresaría. Entonces, necesitamos otras formas de encontrarlos. Hablaremos de ellos en la próxima conferencia, ¿de acuerdo?


ADN recombinante: comprensión de grado 9 para la biología de IGCSE 5.12 5.13 5.14

En la última publicación sobre este tema, expliqué sobre los dos tipos de enzimas necesarias para la modificación genética de organismos:

Enzimas de restricción que pueden cortar moléculas de ADN en secuencias objetivo específicas, lo que a menudo resulta en fragmentos con extremos pegajosos

ADN ligasa que une fragmentos para formar una sola molécula de ADN

El programa de estudios de EdExcel iGCSE utiliza el ejemplo de la modificación genética de bacterias para producir insulina humana. La insulina humana es una hormona que ayuda a regular la concentración de glucosa en la sangre. Se produce en el páncreas cuando la concentración de glucosa en sangre aumenta demasiado y hace que las células del hígado absorban glucosa de la sangre y la conviertan en la molécula de almacenamiento de glucógeno. Los pacientes con diabetes tipo I no pueden producir su propia insulina y, por lo tanto, deben inyectarse varias veces al día después de las comidas para asegurarse de mantener una concentración constante y saludable de glucosa en la sangre.

Las bacterias pueden modificarse genéticamente para que produzcan insulina humana. Estas bacterias transgénicas se pueden cultivar en un fermentador y la insulina producida se puede extraer, purificar y vender.

¿Cómo se consigue el gen de la insulina humana?

Bueno, la respuesta honesta es que hay una variedad de formas de lograrlo. Ahora se puede sintetizar artificialmente, ya que conocemos la secuencia de bases exacta del gen, pero también se puede cortar de una biblioteca de ADN humano utilizando una enzima de restricción. También hay otras formas, pero en aras de la brevedad (y la cordura) no voy a entrar en ellas aquí. [Si está realmente interesado en esto, descubra cómo la transcripción inversa del ARN mensajero de las células del páncreas puede permitirle construir el gen de la insulina].

¿Cómo se introduce el gen de la insulina humana en una bacteria?

Recuerde que las células bacterianas son fundamentalmente diferentes a las células animales y vegetales. Una diferencia es que las células bacterianas no tienen núcleo y su ADN tiene la forma de un anillo que flota en el citoplasma. Muchas bacterias también tienen plásmidos que son pequeños anillos adicionales de ADN y estos proporcionan una forma de introducir un nuevo gen en una bacteria.

Las bacterias intercambian plásmidos en un proceso llamado conjugación, por lo que es bastante fácil sacar el plásmido de la bacteria. Si el plásmido se abre con el mismo enzima de restricción como se usó para cortar el gen de la insulina humana, los extremos pegajosos coincidirán y, por lo tanto, la ADN ligasa unirá las dos piezas de ADN para formar una plásmido recombinante. El siguiente diagrama muestra el proceso de la hormona del crecimiento humana, pero sería exactamente el mismo para el ejemplo que estamos viendo.

Si los plásmidos recombinantes se insertan en bacterias, las bacterias leerán el gen de la insulina humana y producirán la proteína insulina.

¿Cómo se cultivan las bacterias transgénicas a escala industrial?

Las bacterias que han absorbido el plásmido recombinante se cultivan en un fermentador. Esta es una tina grande de acero inoxidable (fácil de limpiar y esterilizar) que a menudo tiene varias características de diseño conservadas entre diferentes variedades:

El fermentador suele tener un camisa de refrigeración para llevar el exceso de calor. La chaqueta a menudo tiene una tubería de entrada de agua fría y se lleva el agua más caliente. Tiene que haber algún mecanismo para mezcla el contenido del fermentador, por lo que el diagrama de arriba muestra paletas conectadas a un motor. Los fermentadores también necesitan entrada esterilizada sistema para introducir aire, agua y nutrientes en el fermentador pero sin introducir bacterias y hongos extraños. Se necesita aire ya que las bacterias son aeróbicas y necesitan oxígeno para respirar.

Si las bacterias del fermentador contienen el gen de la insulina humana, podrán producir insulina humana. Esto se puede extraer, purificar y vender al NHS para tratar a los diabéticos tipo I.


Restricción de ADN

El descubrimiento de enzimas que podían cortar y pegar ADN hizo posible la ingeniería genética. Las enzimas de restricción, que se encuentran naturalmente en las bacterias, se pueden usar para cortar fragmentos de ADN en secuencias específicas, mientras que otra enzima, la ADN ligasa, puede unir o volver a unir fragmentos de ADN con extremos complementarios.

Esta animación también está disponible como VIDEO.

El descubrimiento de enzimas que podían cortar y pegar ADN hizo posible la ingeniería genética. Las enzimas de restricción, que se encuentran naturalmente en las bacterias, se pueden utilizar para cortar fragmentos de ADN en secuencias específicas, mientras que otra enzima, la ADN ligasa, puede unir o volver a unir fragmentos de ADN con extremos complementarios.

ADN ligasa, fragmentos de ADN, enzimas de restricción, ingeniería genética, bacterias, secuencias, descubrimiento


¿Qué sucede si inyectamos enzimas de restricción en la sangre? - Biología

¿Está seguro?

Esta acción no se puede deshacer. Esto eliminará permanentemente todas las preguntas practicadas.

¿Está seguro?

Esta acción no se puede deshacer. Esto eliminará permanentemente todas las preguntas practicadas.

Añadir la nota

Para desbloquear todas las explicaciones de 38 capítulos, debe estar inscrito en el curso MasterClass.

ME GUSTARIA SABER MAS

Añadir la nota
Añadir la nota
Añadir la nota

(1) B es hijo de A y C.

(2) C es hijo de A y B.

(3) D es hijo de B y C.

(4) A es hijo de B y C.

Añadir la nota
Añadir la nota

Para desbloquear todas las explicaciones de 38 capítulos, debe estar inscrito en el curso MasterClass.

ME GUSTARIA SABER MAS

Añadir la nota

Para desbloquear todas las explicaciones de 38 capítulos, debe estar inscrito en el curso MasterClass.

ME GUSTARIA SABER MAS

El extracto de Streptococcus en forma de S destruido por calor tratado con proteasas se mezcla con células de Streptococcus en forma de R vivas y se inyecta en ratones vivos. ¿Qué es más probable que suceda?
1. Los ratones vivirían.
2. Los ratones morirían.
3. La sangre de los ratones tendría células R muertas.
4. Una nueva cepa de Streptococcus estará presente en ratones.

Añadir la nota

Para desbloquear todas las explicaciones de 38 capítulos, debe estar inscrito en el curso MasterClass.

ME GUSTARIA SABER MAS

La adición de desoxirribonucleótidos por la ADN polimerasa durante la síntesis de ADN es un proceso endergónico. La fuente de energía utilizada es:
1. ATP.
2. Energía de fotones de luz.
3. Entropía creada a partir de la digestión de proteínas.
4. Los propios nucleótidos

Añadir la nota

Para desbloquear todas las explicaciones de 38 capítulos, debe estar inscrito en el curso MasterClass.

ME GUSTARIA SABER MAS

Se cree que todos los organismos han surgido de un único ancestro lejano. La evidencia más sólida de esto sería:
1. El ADN almacena información genética en todos los organismos.
2. El código genético es universalmente un código triplete.
3. Los aminoácidos especificados por tripletes particulares son casi siempre idénticos entre dos organismos cualesquiera.
4. El código genético es degenerado pero inequívoco.


ADN recombinante: comprensión de grado 9 para la biología de IGCSE 5.12 5.13 5.14

En la última publicación sobre este tema, expliqué sobre los dos tipos de enzimas necesarias para la modificación genética de organismos:

Enzimas de restricción que pueden cortar moléculas de ADN en secuencias objetivo específicas, lo que a menudo resulta en fragmentos con extremos pegajosos

ADN ligasa que une fragmentos para formar una sola molécula de ADN

El programa de estudios de EdExcel iGCSE utiliza el ejemplo de la modificación genética de bacterias para producir insulina humana. La insulina humana es una hormona que ayuda a regular la concentración de glucosa en la sangre. Se produce en el páncreas cuando la concentración de glucosa en sangre aumenta demasiado y hace que las células del hígado absorban glucosa de la sangre y la conviertan en la molécula de almacenamiento de glucógeno. Los pacientes con diabetes tipo I no pueden producir su propia insulina y, por lo tanto, deben inyectarse varias veces al día después de las comidas para asegurarse de mantener una concentración constante y saludable de glucosa en la sangre.

Las bacterias pueden modificarse genéticamente para que produzcan insulina humana. Estas bacterias transgénicas se pueden cultivar en un fermentador y la insulina producida se puede extraer, purificar y vender.

¿Cómo se consigue el gen de la insulina humana?

Bueno, la respuesta honesta es que hay una variedad de formas de lograrlo. Ahora se puede sintetizar artificialmente, ya que conocemos la secuencia de bases exacta del gen, pero también se puede cortar de una biblioteca de ADN humano utilizando una enzima de restricción. También hay otras formas, pero en aras de la brevedad (y la cordura) no voy a entrar en ellas aquí. [Si está realmente interesado en esto, descubra cómo la transcripción inversa del ARN mensajero de las células del páncreas puede permitirle construir el gen de la insulina].

¿Cómo se introduce el gen de la insulina humana en una bacteria?

Recuerde que las células bacterianas son fundamentalmente diferentes a las células animales y vegetales. Una diferencia es que las células bacterianas no tienen núcleo y su ADN tiene la forma de un anillo que flota en el citoplasma. Muchas bacterias también tienen plásmidos que son pequeños anillos adicionales de ADN y estos proporcionan una forma de introducir un nuevo gen en una bacteria.

Las bacterias intercambian plásmidos en un proceso llamado conjugación, por lo que es bastante fácil sacar el plásmido de la bacteria. Si el plásmido se abre con el mismo enzima de restricción como se usó para cortar el gen de la insulina humana, los extremos pegajosos coincidirán y, por lo tanto, la ADN ligasa unirá las dos piezas de ADN para formar una plásmido recombinante. El siguiente diagrama muestra el proceso de la hormona del crecimiento humana, pero sería exactamente el mismo para el ejemplo que estamos viendo.

Si los plásmidos recombinantes se insertan en bacterias, las bacterias leerán el gen de la insulina humana y producirán la proteína insulina.

¿Cómo se cultivan las bacterias transgénicas a escala industrial?

Las bacterias que han absorbido el plásmido recombinante se cultivan en un fermentador. Esta es una tina grande de acero inoxidable (fácil de limpiar y esterilizar) que a menudo tiene varias características de diseño conservadas entre diferentes variedades:

El fermentador suele tener un camisa de refrigeración para llevar el exceso de calor. La chaqueta a menudo tiene una tubería de entrada de agua fría y se lleva el agua más caliente. Tiene que haber algún mecanismo para mezcla el contenido del fermentador, por lo que el diagrama de arriba muestra paletas conectadas a un motor. Los fermentadores también necesitan entrada esterilizada sistema para introducir aire, agua y nutrientes en el fermentador pero sin introducir bacterias y hongos extraños. Se necesita aire ya que las bacterias son aeróbicas y necesitan oxígeno para respirar.

Si las bacterias del fermentador contienen el gen de la insulina humana, podrán producir insulina humana. Esto se puede extraer, purificar y vender al NHS para tratar a los diabéticos tipo I.


Información suplementaria

Este archivo contiene las figuras complementarias 1-11, la tabla complementaria 1 y las leyendas de las películas complementarias 1-3. (PDF de 1937 kb)

Película complementaria 1

Esta película muestra el movimiento de los glóbulos rojos a través de los vasos sanguíneos en embriones de tipo salvaje. (MOV 707 kb)

Película complementaria 2

Esta película muestra el movimiento de los glóbulos rojos a través de los vasos sanguíneos en embriones inyectados con cdh5 MO. (MOV 1831 kb)

Película complementaria 3

Esta película muestra el movimiento de los glóbulos rojos a través de los vasos sanguíneos en embriones inyectados con cdh5 GoldyTALEN. (MOV 89 kb)


¿Qué sucede si inyectamos enzimas de restricción en la sangre? - Biología

¿Está seguro?

Esta acción no se puede deshacer. Esto eliminará permanentemente todas las preguntas practicadas.

¿Está seguro?

Esta acción no se puede deshacer. Esto eliminará permanentemente todas las preguntas practicadas.

Añadir la nota

Para desbloquear todas las explicaciones de 38 capítulos, debe estar inscrito en el curso MasterClass.

ME GUSTARIA SABER MAS

Añadir la nota
Añadir la nota
Añadir la nota

(1) B es hijo de A y C.

(2) C es hijo de A y B.

(3) D es hijo de B y C.

(4) A es hijo de B y C.

Añadir la nota
Añadir la nota

Para desbloquear todas las explicaciones de 38 capítulos, debe estar inscrito en el curso MasterClass.

ME GUSTARIA SABER MAS

Añadir la nota

Para desbloquear todas las explicaciones de 38 capítulos, debe estar inscrito en el curso MasterClass.

ME GUSTARIA SABER MAS

El extracto de Streptococcus en forma de S destruido por calor tratado con proteasas se mezcla con células de Streptococcus en forma de R vivas y se inyecta en ratones vivos. ¿Qué es más probable que suceda?
1. Los ratones vivirían.
2. Los ratones morirían.
3. La sangre de los ratones tendría células R muertas.
4. Una nueva cepa de Streptococcus estará presente en ratones.

Añadir la nota

Para desbloquear todas las explicaciones de 38 capítulos, debe estar inscrito en el curso MasterClass.

ME GUSTARIA SABER MAS

La adición de desoxirribonucleótidos por la ADN polimerasa durante la síntesis de ADN es un proceso endergónico. La fuente de energía utilizada es:
1. ATP.
2. Energía de fotones de luz.
3. Entropía creada a partir de la digestión de proteínas.
4. Los propios nucleótidos

Añadir la nota

Para desbloquear todas las explicaciones de 38 capítulos, debe estar inscrito en el curso MasterClass.

ME GUSTARIA SABER MAS

Se cree que todos los organismos han surgido de un único ancestro lejano. La evidencia más sólida de esto sería:
1. El ADN almacena información genética en todos los organismos.
2. El código genético es universalmente un código triplete.
3. Los aminoácidos especificados por tripletes particulares son casi siempre idénticos entre dos organismos cualesquiera.
4. El código genético es degenerado pero inequívoco.


MICROBIOLOGÍA 101 TEXTO DE INTERNET

Cuáles son las HERRAMIENTAS BÁSICAS de GE cómo y cómo funcionan.

Cómo se realiza la CLONACIÓN GENÉTICA.

Cómo se puede utilizar el ADN para IDENTIFICAR todos los organismos vivos

Cómo podemos DETECTAR CANTIDADES MUY MINÚSCULAS de ADN incluso cuando pueden tener millones de años.

Además, se presentarán los problemas ÉTICOS de la revolución GE y se considerarán algunas posibles formas de abordarlos.

DESCRIPCIÓN DE LA BIOLOGÍA MOLECULAR

He enumerado algunos de los cambios que puede experimentar durante su vida, de hecho algunos en los próximos años. Con la secuenciación del GENOMA HUMANO ENTERO anticipada hacia el cambio de siglo, se desbloqueará un conjunto completamente nuevo de posibilidades. Actualmente (otoño de 1996) hemos secuenciado> 10,000 de los

100.000 genes humanos, y la tasa de secuenciación se acelera a medida que se mejoran las técnicas de secuenciación. Actualmente se conocen unas 3.000 enfermedades genéticas humanas. Esto significa que aproximadamente el 14% de los recién nacidos padecen una enfermedad genética "visible". Esto no comienza a incluir las "tendencias" basadas en la genética (desarrollar cáncer, artritis, tuberculosis, resfriados, asma, gripe, etc.) y / o "afecciones" que todos tenemos. ¿Qué afecciones genéticas tiene usted? Por ejemplo, mi medio hermano y yo sufrimos de una condición genética llamada celiaquía, lo que significa que la proteína de trigo (gluten) hace daño a las células de nuestro intestino y no podemos comer pizza, etc. ya que no comemos productos de trigo. El esprúe es una "condición" genética común que afecta hasta al 25% de los irlandeses y menos de otros grupos étnicos. ¿Cuántos de los que leen esto son irlandeses? Algunos de ustedes padecen alergias, miopía, migrañas, etc., todo lo cual tiene su base en su genoma. Una vez que se ha cartografiado el genoma humano, no sólo podemos identificar los alelos particulares que tiene cada uno de nosotros, sino que eventualmente encontraremos una manera de reemplazar los "genes indeseables" por "genes buenos".

PREGUNTA DE PENSAMIENTO CRÍTICO: ¿Cómo definimos nosotros, como individuos y sociedad, los genes "buenos y malos"? Por ejemplo, si resulta que los genes son la base del alcoholismo, la homosexualidad, el abuso de menores o la depresión maníaca, ¿nos proponemos "curar" a la gente de estos genes? Si se encuentra un gen "homosexual", ¿qué haría usted si encontrara que un feto suyo es portador de ese gen?

Un problema actual con la revolución genética es que saber qué gen causa una enfermedad y ser capaz de identificar la presencia de ese gen en una persona, no significa que ENTENDEMOS la biología molecular del proceso de la enfermedad, por lo que generalmente NO PODEMOS PREVENIR o CURAR la enfermedad causada por un gen defectuoso. Un ejemplo de este TERRIBLE DILEMA es que se han descubierto varios genes que predisponen a las mujeres al cáncer de mama (y continuamente se encuentran nuevos). Esto plantea importantes consideraciones éticas y personales.

Si una CURACIÓN o PREVENCIÓN no es posible, ¿se le debe decir a la mujer que es portadora de ese gen?

Si una cura o prevención NO ES POSIBLE, ¿le gustaría saber que tenía una bomba de tiempo en su interior?

  • Examinemos una situación más de "zona gris" antes de continuar. La depresión maníaca (DM) es una enfermedad que afecta a muchas personas. En algunos es relativamente leve, mientras que en otros se cobra un precio terrible, que a menudo conduce al SUICIDIO. También parece tener una base genética, ya que es hereditario y, a menudo, estigmatiza tanto a los miembros afectados como a los no afectados. Apostaría dinero a que la mayoría de los que leen esto conocen a alguien que es maníaco depresivo y, por supuesto, algunos de ustedes son médicos. Sin embargo, la enfermedad a menudo se puede tratar con medicamentos económicos y psicoterapia, aunque muchas personas sufren tormento durante años antes de ser diagnosticadas y tratadas adecuadamente. Un aspecto interesante de MD es que muchos de los artistas y políticos creativos han sido (quizás algunos de nuestros políticos actuales son MD) MD. Robert Schumann, Lord Byron, Vincent van Gogh, Winston Churchill y Alfred, Lord Tennyson todos sufrieron los síntomas clásicos de MD (ver "Enfermedad maníaco-depresiva y creatividad", Sci. Am. Febrero de 1995 y noviembre de 1995). Una vez que identificamos los genes que causan la MD, podemos usar esta información para tomar decisiones sobre si tener hijos con el gen MD positivo o ABORTAR cualquier feto portador de este gen. ¿Qué harías? Eventualmente seremos capaces de curar (reprimir) completamente la condición. ¿La ramificación de estos hallazgos hará que el mundo sea menos interesante y estimulante? ¿Cuál es tu opinión?

¿Debería su cónyuge, jefe, compañía de seguros, empleador potencial, etc. tener acceso a su información genética? ¿Puede pensar en situaciones en las que sería lógico y razonable que otros tuvieran esta información? ¿Qué tal el ejército? ¿La CIA?

Si fuera dueño de una compañía de seguros de vida, ¿le haría sus donaciones políticas a un congresista que estuviera a favor de exigir a los posibles titulares de pólizas que dieran esta información a su compañía de seguros?

¿Quién paga el examen de detección de genes de enfermedades, cuyo costo actualmente es elevado? ¿Debería pagar por su proyección y viceversa?

¿Qué pasa si controlas la información genética y sabes que darla conducirá a un aborto? ¿Qué harías?

¿Qué pasa si tienes acceso a la información genética de alguien con quien tu hija / hijo, hermana / hermano, etc. se va a casar y no crees que le hayan informado sobre una "condición" genética grave? ¿Podrías decirme? ¿A quién pertenece tu lealtad? ¿Qué es ético aquí?

Un último recordatorio para cualquiera que esté considerando evitar estos problemas, actualmente se están llevando a cabo ensayos de terapia génica (pero tienen problemas para funcionar: TIME 10/9/95 Science 269: 1050 [1995]), las personas están decidiendo abortar sobre la base de los resultados de las pruebas genéticas fetales y el número de genes defectuosos identificados aumentan casi a diario (y algunos de los que encuentran serán los que usted y yo llevamos).

HISTORIA DE LA INGENIERÍA GENÉTICA

En la década de 1950 se había observado que si uno cultivaba un bacteriófago particular en una cepa huésped mutante bacteriana particular (A) y luego infectaba una cepa mutante bacteriana (B), de la misma especie, con el fago A, el rendimiento del fago de la cepa B fue MUY BAJA. Sin embargo, si tomaba los pocos fagos B producidos e infectaba la cepa B con ellos, la producción de fagos ahora era NORMAL. Posteriormente, en la década de 1960, se descubrió que el ADN del fago que crecía en la cepa B había sido MODIFICADO QUÍMICAMENTE para que no pudiera ser escindido (destruido) por una ADNasa en la cepa B. Se encontró que la ADNasa involucrada en esta escisión era algo específica, ya que principalmente cortaba el ADN en CIERTAS SECUENCIAS, a menos que estas secuencias hubieran sido MODIFICADAS QUÍMICAMENTE por enzimas en la célula (ausentes en la cepa A). Todas las ADNasas anteriores cortan el ADN al azar, por lo que este hallazgo sugirió que el ADN podría cortarse en FRAGMENTOS ESPECÍFICOS que SIEMPRE contendrían el MISMO CONJUNTO DE GENES entre los sitios de corte. Sin embargo, estas primeras DNasas "específicas" no resultaron ser tan ESPECÍFICAS como se esperaba. Finalmente, en 1970, Hamilton Smith descubrió accidentalmente que una ADNasa de la bacteria, Haemophilus influenzae, CORTA EL ADN ÚNICAMENTE en SECUENCIAS DE ADN ÚNICAS conocidas como SITIOS PALINDRÓMICOS.

PALINDROMES

En el ADN, un SITIO PALINDRÓMICO es una SECUENCIA DE PARES DE BASE en el ADN de doble hebra que lee lo mismo hacia atrás y hacia adelante a través de la doble hebra. Por ejemplo, la secuencia de pares de bases GAATTC es un palíndromo porque ambas secuencias de la doble hebra LEEN LO MISMO cuando se leen desde sus respectivos extremos "G" o "C" (hebra COMPLEMENTARIA = CTTAAG). Las enzimas que cortan estos sitios específicos se denominan ENZIMAS DE RESTRICCIÓN (RE). Según los TIPOS DE CORTES que realizan, existen dos tipos de RE:

Un grupo corta directamente a través del ADN de doble hebra, produciendo ADN de extremos romos (Fig. 2).

Otro tipo corta la hebra de ADN DEL CENTRO de los sitios palindrómicos, pero entre las MISMAS DOS BASES en las hebras opuestas. Esto deja una o más bases colgando en cada hebra y tales extremos se denominan EXTREMOS PEGAJOSOS (Fig. 1) porque forman BONOS DE HIDRÓGENO con sus contrapartes de corte complementario.

Por ejemplo, en la secuencia de bases G A ATTC, el RE que corta este sitio escinde el ADN entre la "G" y la "A" en cada hebra complementaria, dejando así los salientes de AATT y TTAA respectivamente (Fig. 1). Se han aislado más de 200 RE diferentes que cortan en muchas secuencias de ADN específicas diferentes. Todos son MUY ESPECÍFICOS y esta especificidad es la CLAVE para su uso. Se han encontrado RE que cortan en sitios palindrómicos de 4, 5, 6, 8, 9 y 11 pares de bases. De ello se deduce que cuanto MÁS PARES DE BASE en el sitio palindrómico, MENOS PROBABLE que exista un sitio estadísticamente. Es decir, un RE de corte de 4 bases corta el mismo ADN muchas más veces que un cortador de 8 bases. Los sitios de corte impares no son verdaderos palíndromos de ADN, ya que el pb central se lee diferente en las dos direcciones. Por ejemplo, AA? TT es un sitio de corte de 5 pb, donde? = varias bases diferentes.

Figura 1. Corte de punta pegajosa con enzima de restricción. Las flechas rojas indican las posiciones donde el RE corta el ADN. Cuando los soportes complementarios se retiran, quedan los voladizos del "extremo pegajoso".

Figura 2. Cortes de extremos romos por una enzima de restricción. Los RE de corte de extremos romos escinden el ADN entre dos bases en el medio de un sitio palindrómico.

PREGUNTA DE PENSAMIENTO CRÍTICO: Los siguientes son ejemplos de sitios de ADN RE en una sola hebra. Agregue las bases complementarias y busque los sitios RE: CCTAGT AATCCTAGGACG AAATTAATCGG TAAGGCGCGCCTAAT TACGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGTATCCCCGGGTACCGAGCTCGAATTCACT.

Hay 10 sitios de ER en este último, ¿puedes encontrar los diez?

El último componente importante de la ingeniería genética es una enzima llamada LIGASA. La ligasa es una enzima que une covalentemente el esqueleto de azúcar-fosfato de las bases. La ligasa también participa en la replicación del ADN. En efecto, LIGASE invierte la acción del RE, que rompe los enlaces de la cadena principal azúcar-fosfato. La ligasa requiere energía para formar estos enlaces (Fig. 3). Ligase unirá los extremos "pegajosos" o los extremos "romos", pero es más eficiente para cerrar los extremos pegajosos porque los "voladizos pegajosos" de estos extremos agregan estabilidad que mantiene los soportes juntos mientras la ligasa funciona, mientras que los extremos romos son MENOS ESTABLE. Los extremos pegajosos deben tener el MISMO "saliente de la base" (Fig. 1), pero CUALQUIER EXTREMO RONTO se puede unir a cualquier otro extremo romo (Fig. 2).

Figura 3. La reacción de la ligasa. Los extremos pegajosos de dos cadenas de ADN se alinean de acuerdo con su enlace de hidrógeno pb. Los sitios de corte se indican con flechas azules. La ligasa se une a las hebras de ADN con enlaces de hidrógeno y forma enlaces covalentes entre los dos extremos del ADN (enlaces rojos), uniéndolos así. De manera similar, si los extremos romos del ADN se unen, la ligasa puede formar enlaces covalentes entre ellos.

Revisión de los componentes de GE:

(1) El ADN de doble hebra contiene sitios de enzimas de restricción palindrómicas.

(2) Muchos tipos de enzimas de restricción cortan o escinden sitios palindrómicos en la muestra de ADN de doble hebra formando un extremo pegajoso o romo.

(3) La enzima ligasa más una fuente de energía fusionan o unen dos extremos pegajosos o romos del ADN.

LOS PASOS DE LA INGENIERÍA GENÉTICA

Aislar el ADN FUENTE y VECTOR. Los ADN deben estar relativamente libres de materiales contaminantes que interfieran con los pasos enzimáticos posteriores.

Tanto el ADN de origen como el vector se cortan con ENZIMAS DE RESTRICCIÓN. Cuando se forman extremos pegajosos, el ADN se corta con las mismas enzimas de restricción, pero los RE que producen extremos romos también funcionan bien en la clonación.

El vector y los ADN de origen se mezclan con un SISTEMA DE LIGASAS y se unen covalentemente.

Finalmente, el ADN LIGADO se TRANSFORME en una célula huésped. Por lo general, la célula huésped es una bacteria COMPETENTE, pero cada vez se utilizan más células eucariotas. Una vez que se ha producido un crecimiento adecuado, las células huésped se examinan para determinar la PRESENCIA de la fuente o ADN CLONADO en su citoplasma.

El proceso completo de clonación a menudo toma MENOS DE UN DÍA y se lleva a cabo utilizando volúmenes de 1,000 microlitros o menos. El examen del hospedador transformado en busca del gen de interés puede llevar aproximadamente un día más. Se dice que un gen que se ha transferido con éxito de esta manera ha sido CLONADO. El proceso se denomina "CLONACIÓN", "TECNOLOGÍA DE ADN RECOMBINANTE" o "ADN RECOMBINANTE". Estos pasos se resumen en la figura 4 a continuación.

Figura 4. Clonación. Para ver otra figura que ilustra la clonación, haga clic aquí y vea la Fig. 11a.

USOS DEL ADN CLONADO.

SECUENCIA: La secuenciación determina la secuencia de pares de bases de un gen. Al leer el código de 3 letras, la secuenciación también describe la SECUENCIA DE AMINOÁCIDOS traducida de ese gen.

MUTACIÓN: La secuencia del gen bp se puede cambiar de formas específicas y el gen modificado se puede insertar nuevamente en su anfitrión original para ver qué hace cada mutación específica. Mientras que la mutación espontánea es aleatoria, ahora se dispone de técnicas que permiten CAMBIAR cualquier codón dentro de un gen por cualquier otro codón. Por lo tanto, es posible estudiar los efectos de los CAMBIOS DE AMINOÁCIDOS ÚNICOS en la función del producto génico, que es, después de todo, el propósito final del ejercicio.

Reemplazar una forma mutada del gen en la célula huésped original con una forma sana del gen para ver exactamente lo que hace en su lugar de residencia previsto.

Utilizar el gen amplificado para producir CANTIDADES ENORMES del PRODUCTO GENÉTICO con fines comerciales. Así es como se producen productos como la insulina humana, la hormona del crecimiento humano, el activador del plasminógeno, las interlucinas y la hormona de la leche bovina.

INSERTAR el gen en OTRA ESPECIE para algún propósito. Se dice que tales animales o plantas son TRANSGÉNICOS. Por ejemplo, muchos cultivos están protegidos contra las larvas de orugas porque se ha insertado un gen de una bacteria en sus células. Este gen produce una proteína que es ALTAMENTE y ESPECÍFICAMENTE TÓXICA para las larvas de muchas polillas y mariposas que atacan los cultivos alimentarios.

ORGANISMOS TRANSGÉNICOS

Hay un LADO ABAJO de GE. Los mismos procedimientos que se pueden usar para producir una mejor cosecha, o insulina humana, también se pueden emplear para hacer un PATÓGENO más PODEROSO. Existe evidencia de que algunos países lo han hecho o están considerando hacerlo. Por ejemplo, aparentemente Irak estaba cultivando patógenos bacterianos para la guerra biológica, pero se le impidió usarlos cuando amenazamos con represalias atómicas. Es sólo un pequeño salto en el "razonamiento" para considerar la ingeniería como un "mejor patógeno" con el que destruir a un enemigo odiado (rellene el espacio en blanco: las noticias informan que algunos estadounidenses consideran que cualquiera que trabaje para el gobierno es el enemigo). Para más información lea "Los espectros de las armas biológicas" Scientific Am. Diciembre de 1996, pág. 60.

Figura 5. El uso de la clonación de genes para amplificar el ADN clonado y / o producir lotes del producto del gen clonado.

PREGUNTA DE PENSAMIENTO CRÍTICO: ¿Qué debemos hacer para regular las plantas y animales modificados genéticamente? ¿Deberíamos exigir que se sometan a pruebas de seguridad, que se etiqueten como GE? ¿Puede pensar en otras consideraciones con respecto a estos "productos"? ¿Comerá "alimentos transgénicos"?

HUELLA DE ADN

Los TRES principios básicos necesarios para comprender las huellas dactilares del ADN y todo lo que se deriva de ella ya los conoce (el principio de unión ligando / receptor, consulte la figura 2, capítulo 7), pero vale la pena tomarse un momento para revisarlos.

EL EMPAREJAMIENTO BÁSICO de AT (AU) y amp GC es el PRINCIPIO BÁSICO de este procedimiento. Si comprende esto, todo lo demás encajará fácilmente.

La ESPECIFICIDAD de la actividad enzimática es el segundo principio CRUCIAL para comprender las huellas dactilares del ADN. Esto se refiere al corte de ADN por ENZIMAS DE RESTRICCIÓN específicas en secuencias palindrómicas ÚNICAS.

El reconocimiento de que un CAMBIO en un PAR DE BASE ÚNICA (una mutación) puede HACER un RE-sitio donde no existía anteriormente o puede ELIMINAR o ELIMINAR un sitio RE de un gen. Una analogía sería "mutar" su número de teléfono por una letra. Las personas que llaman obtendrían una persona diferente.

Para comprender las huellas dactilares del ADN, la molécula de ADN de doble hebra debe verse como una cadena con sitios de ENZIMAS DE RESTRICCIÓN ALEATORIA (palíndromos) ubicados a lo largo de su longitud. Si cada uno de estos diversos sitios de restricción únicos estuviera marcado con un color diferente, el ADN aparecería como una cinta despojada de varios colores al azar. Si un conjunto de sitios únicos de enzimas de restricción se colorearan de ROJO y se agregara la enzima de restricción ROJA apropiada, el ADN se dividiría en una serie de FRAGMENTOS DE VARIOS TAMAÑOS dependiendo de dónde se ubicaran los SITIOS ROJOS a lo largo de la molécula de ADN (Fig.6) . Es fácil entender que el grupo de FRAGMENTOS DE DIFERENTES TAMAÑOS sería ÚNICO para dos cadenas de ADN con los sitios de restricción ROJOS ubicados en DIFERENTES LUGARES a lo largo de sus respectivas cadenas dobles de ADN. La adición de una enzima de restricción VERDE que corta los SITIOS VERDES produciría un grupo diferente de fragmentos de tamaño. Cada uno de estos grupos de fragmentos producidos por enzimas de restricción representaría una HUELLA DIGITAL única de ese ADN (Fig. 6).

Figura 6. En esta FIGURA hay dos genes con los sitios palindrómicos para dos enzimas de restricción diferentes MARCADOS CON BARRAS VERDES O ROJAS. Se muestra el número y tamaño de los fragmentos de ADN que resultarían si el ADN que contiene estos dos genes se cortara con las respectivas enzimas de restricción. Determina el patrón que obtendrás si cortas este ADN con AMBAS ENZIMAS al MISMO TIEMPO y colócalo desde el fragmento más pequeño hasta el más grande.

Los fragmentos de ADN se visualizan usando la técnica conocida como ELECTROFORESIS EN GEL, que realizó en el ejercicio de laboratorio 15. Brevemente, se usan geles porosos compuestos de un PLÁSTICO llamado ACRILAMIDA o de un derivado del agar, llamado AGAROSA, para separar fragmentos de ADN basados ​​en Talla. Los geles se preparan con pocillos en los que se AÑADEN los fragmentos de ADN. Los geles se sumergen, bajo una solución tampón de electrolito entre un electrodo positivo y uno negativo, las soluciones que contienen ADN se agregan a los pocillos y se enciende la corriente. Los fragmentos de ADN están CARGADOS NEGATIVAMENTE, por lo que los pocillos que los contienen se colocan más cerca del electrodo negativo. Cuando se activa la corriente, el ADN se mueve a través de los poros del gel HACIA EL ELECTRODO POSITIVO. Los fragmentos más cortos se mueven MÁS RÁPIDO porque pueden navegar a través de los poros del gel más fácilmente, mientras que los fragmentos de ADN más largos se mueven PROPORCIONALMENTE MÁS LENTAMENTE a través de los poros. El resultado es una separación de los fragmentos de ADN en función de su longitud (TAMAÑO). Los ADN se tiñen con tintes que se adhieren al ADN y emiten una fuerte fluorescencia cuando se exponen a la luz ultravioleta. Los fragmentos de ADN de varios tamaños aparecen como una serie de bandas que se asemejan a un CÓDIGO DE BARRAS. Vea la figura 13.

MUTACIONES & amp; ADN-HUELLA DIGITAL

En la Figura 7 se representa el patrón de gel de un análisis hipotético del ADN de O.J. frente a una muestra de ADN desconocido. Los dos ADN aislados se trataron con el mismo RE y los fragmentos se separaron en un gel de agarosa. Se ven dos patrones únicos de fragmentos de enzimas de restricción. La conclusión es que las muestras de sangre provienen de DIFERENTES INDIVIDUOS. La FUENTE de los ADN influye claramente en la importancia de estos resultados. Por ejemplo, si las dos muestras fueron recolectadas en la escena del crimen, significaría una cosa, pero si la muestra de ADN desconocida provenía de la camisa de OJ y coincidía con la de una de las víctimas en la escena del crimen, el los datos adquieren más importancia.

Figura 7. Claramente, el ADN de la escena del crimen no es el de O.J., ya que los patrones de fragmentos (la huella digital del ADN) son diferentes. Si hubieran sido lo mismo, ¿qué diría eso de sobre la inocencia o culpabilidad de O.J.?

HIBRIDACIÓN

RESPUESTA: Esto es exactamente lo que sucede. Cuando el ADN genómico se trata con un RE y se separa en un gel, lo que se ve es un frotis continuo compuesto por miles de fragmentos de ADN individuales. Este problema se resuelve mediante una técnica conocida como HIBRIDACIÓN.

De nuevo, la hibridación depende del principio básico de la UNIÓN DE HIDRÓGENO entre los enlaces GC y amp AT en los ácidos nucleicos. Los principios de los pasos de hibridación son:

Las hebras de ADN se SEPARAN rompiendo los enlaces de hidrógeno entre las bases con calor para producir HILAS ÚNICAS.

La separación de las hebras depende ESTRICTAMENTE de dos factores: la TEMPERATURA (cantidad de energía térmica) y el NÚMERO de enlaces de hidrógeno (un emparejamiento de bases incorrecto NO forma enlaces H).

Cuando la temperatura desciende, las hebras de ADN individuales en la misma solución que son complementarias SE UNEN ESPONTÁNEAMENTE al emparejarse a través de sus respectivas asociaciones AT & amp GC. La fuerza de su asociación posterior depende de la temperatura y el número total de pares de bases COINCIDENTES.

El ADN de PRUEBA o MUESTRA generalmente está FIJADO o UNIDO a una superficie sólida en un ESTADO DE UN SOLO HILO. Un fragmento de ADN de SECUENCIA CONOCIDA al que se une algo que se puede DETECTAR o VER se mezcla con el ADN unido y los dos se incuban juntos en condiciones que permitirán que las secuencias de ADN COMPLEMENTARIAS se unan a través del enlace de hidrógeno apropiado. La molécula de ADN que se puede detectar se llama SONDA.

Figura 8. Sonda de hibridación. Un fragmento corto de ADN de secuencia conocida (bases negras) tiene una sustancia REPORTER adjunta. Este informador suele ser un elemento radiactivo como el fósforo-32 o una enzima que induce la producción de luz a partir de una molécula de sustrato y se indica en esta figura mediante la bombilla. Si la secuencia de la sonda encuentra una secuencia de bases complementaria en el ADN de la muestra o el objetivo unido, se unirá por hidrógeno. Cuando el exceso de sonda no unida se elimina por lavado, el REPORTERO puede detectar la ubicación de la sonda unida y su ADN complementario en la sonda.

Es decir, cuanto MÁS enlaces de hidrógeno hay, MÁS ALTA debe ser la temperatura para SEPARAR completamente dos hebras de ADN y mantenerlas separadas. Por ejemplo, si hubiera dos grupos de ADN compuestos por 200 pares de bases PERFECTAMENTE complementados, se necesitaría una temperatura de 58 o C. para separarlos. Sin embargo, si solo 199 de los pares de bases fueran correctos, solo se necesitarían 57 o C. para separarlos si solo hubiera 100 pares de bases correctos, las cadenas de ADN se desmoronarían en

29 o C, es decir, menos enlaces requieren menos calor (energía = temperaturas más bajas) para romperlos.

Figura 9. En esta figura, un fragmento corto de ADN, llamado SONDA (Estrella Rosa) se mezcla con dos hebras largas de ADN diferentes. Una de estas cadenas largas contiene una secuencia de pb que coincide exactamente con la de la sonda, mientras que la otra difiere con respecto a un solo pb (óvalo amarillo). A 55 ° C, la sonda se une a AMBAS moléculas de ADN largas, sin embargo, a 65 ° C, la sonda no se une a la molécula de ADN larga con un solo emparejamiento erróneo de pares de bases. La sonda no puede unirse a ninguna molécula de ADN larga a 90 o C. ¿Cuáles crees que podrían ser los resultados a una temperatura de 60 o C?

  1. El ADN aislado está FRAGMENTADO (CORTE) con enzimas de restricción.
  2. El ADN cortado se separa en fragmentos de acuerdo con el TAMAÑO en un gel.
  3. Los fragmentos de ADN se transfieren, EN POSICIÓN, a una membrana a la que SE UNEN FIRMEMENTE.
  4. El ADN unido a la membrana se empapa en una solución que contiene ADN-SONDA que está marcado con algo que puede DETECTARSE (visto por el ojo).
  5. La mezcla de la sonda de ADN unida a la membrana se incuba a una temperatura diseñada para que SÓLO LAS hebras de ADN de la SONDA que tienen un alto grado de COMPLEMENTARIDAD (coincidencia de pares de bases) con las hebras de ADN unidas a la membrana puedan unirse (enlace de hidrógeno ) entre sí.
  6. La sonda no unida se lava y la posición de la sonda unida se determina usando su sistema de detección de la sonda.

Figura 10. El procedimiento de hibridación.

Todo el procedimiento se llama HIBRIDACIÓN. La hibridación funciona debido a la SECUENCIA DE LA SONDA. Una sonda determinada solo se unirá al ADN que esté adherido a la membrana SI ENCUENTRA una secuencia de pares de bases de ADN COMPLEMENTARIA o COINCIDENTE que forme suficientes enlaces para permanecer juntos en las condiciones de calentamiento utilizadas. Por tanto, si no se encuentran secuencias complementarias coincidentes, NINGUNA SONDA se unirá (Fig. 10, ADN verde). Si uno o dos de los miles de fragmentos de ADN unidos contienen una secuencia complementaria a la secuencia en la sonda, la sonda se UNirá solo a estos fragmentos y, por lo tanto, se UNIRÁ A LA MEMBRANA a través de esta asociación con el ADN complementario unido a la membrana. (Fig. 10, ADN rojo). Es posible elegir sondas que se sabe que se unen a secuencias específicas o se pueden hacer sondas artificiales de SECUENCIAS CONOCIDAS, por aproximadamente $ 1.00 / base y enviárselas en 48 horas. SE PUEDEN PEDIR A TRAVÉS DE INTERNET.

Figura 11. El gel original, que se muestra en el medio, produce un frotis de fragmentos de ADN genómico (ver Fig. 13). Dentro de esos 1000, s de fragmentos están los fragmentos que se muestran en el gel de la izquierda cortados de una sección de las dos moléculas de ADN originales que se muestran en la parte superior izquierda. Cuando el frotis de fragmentos, fijados a una membrana, se hibridan con la sonda (ADN con indicador adjunto [estrella verde], Fig. 8), la sonda HIBRIDIZA (se une) solo a aquellos fragmentos que contienen secuencias de ADN que complementan las secuencias presentes en la sonda, es decir, aquellas regiones DIRECTAMENTE DEBAJO del ADN de la sonda. La ubicación (óvalos rosados) de dichos fragmentos complementarios unidos a la membrana se muestra en el gel de la derecha. Así, el sistema de detección sólo "VE" los óvalos rosados. Consulte la Fig. 13 para ver la detección con película de rayos X de fragmentos de ADN de un frotis de ADN genómico.

Figura 12. Proyecto de tarea.

En la Fig. 12, se hibridan tres SONDAS diferentes (A, B y C) contra los fragmentos de ADN unidos a la membrana separados que se muestran a la derecha (de 3 geles duplicados). Como ejercicio, determine a QUÉ BANDAS se hibridará (se unirá) cada una de las tres sondas, es decir, dibuje tres geles duplicados, 1, 2 y 3 y encierre en un círculo la (s) banda (s) en el gel 1 a las que se unirá la sonda A en los geles 2 & amp 3 hacen lo mismo con las sondas B & amp C respectivamente.

Figura 13. Estos son tres geles experimentales que muestran el resultado de un procedimiento de hibridación. El gel A muestra el patrón de bandas visto cuando el ADN genómico, digerido con una enzima de restricción, se separa en un gel de agarosa. Los frotis en los carriles 1 a 9 representan miles de fragmentos de ADN individuales producidos por la digestión con enzimas de restricción. Las bandas que se ven en estos carriles se deben a la alta concentración de ciertos genes. Los geles B y C muestran ejemplos de patrones de bandas obtenidos cuando los frotis de ADN genómico, unidos a una membrana, se hibridan con sondas específicas. Las sondas solo se unen, o se hibridan con, algunos de los miles de fragmentos que contienen secuencias de bases COMPLEMENTARIAS a las de la sonda. Unida a las sondas hay una sustancia que produce LUZ cuando se trata con ciertos químicos y esta luz se detecta con una película fotográfica, tomando una fotografía de cada uno de los lugares donde las sondas se unen a un fragmento de ADN complementario en la membrana. haga clic aquí y luego haga clic en "Hibridación" para ver algunas otras caricaturas de Southern Blotting e ilustraciones de otras técnicas de biología molecular.

La Figura 14 ilustra cómo se analizó la sangre de la prueba de O.J. para determinar coincidencias. El ADN de las diversas muestras de sangre (de los guantes, el Bronco, los calcetines, los cuerpos, etc.) se extrajo, se digirió con una o más enzimas de restricción, se separó en geles, se transfirió a membranas de unión al ADN y se hibridó con varias sondas. . A continuación, se comparó el patrón de los fragmentos de ADN (bandas) de las muestras que se "iluminaban" en busca de similitudes y diferencias.

Preguntas frecuentes: acerca de las huellas dactilares de ADN.

1 Qué tan bueno (exacto) es en la identificación. Por ejemplo, ¿es tan bueno como las huellas dactilares clásicas?

Respuesta: En teoría, con la excepción de los gemelos idénticos, TODOS en este planeta tienen una huella de ADN diferente. Es decir, la toma de huellas dactilares de ADN ES tan buena (distintiva) como la toma de huellas dactilares clásica para la identificación.

2. ¿Cuáles son sus ventajas?

Respuesta: En teoría, las huellas dactilares de ADN funcionarán con cantidades mucho más pequeñas de material que una huella dactilar clásica y el ADN dura mucho más que las huellas dactilares clásicas. Las muestras que contienen ADN que tienen muchos años (hasta 25 millones de años) todavía se pueden utilizar. Solo se requieren cantidades muy pequeñas de ADN para llevar a cabo una prueba de alta precisión. Por ejemplo, la sangre seca, el semen, la saliva, la piel, etc. de las muestras almacenadas en archivos polvorientos durante años todavía se pueden utilizar. También se pueden usar muestras de ADN mezclados. El ADN que contiene pruebas es mucho más difícil de limpiar en la escena del crimen que otras pruebas, como las huellas dactilares clásicas.

3. ¿Cuáles son sus limitaciones?

Respuesta: Actualmente no existen estándares federales aceptados para controlar la calidad de las pruebas de ADN en todo el país. Las pruebas de mala calidad y mal controladas conducen a RESULTADOS CUESTIONABLES y MALOSOS. El laboratorio A puede usar un conjunto de procedimientos y estándares, mientras que el laboratorio B puede usar otro conjunto de procedimientos y estándares. Haciendo difícil las comparaciones entre los resultados de los dos laboratorios. La calidad del personal de laboratorio no está estandarizada. Por ejemplo, los técnicos de laboratorio clínico que trabajan en hospitales y laboratorios clínicos deben estar certificados por sus estados y por una organización nacional que establezca altos estándares de capacitación y experiencia. Los laboratorios clínicos se prueban con frecuencia para determinar si sus procedimientos se realizan correctamente. Reciben y deben analizar muestras de prueba cuya composición es conocida por las agencias de certificación. Los resultados se devuelven a las agencias de certificación para su evaluación. Si un laboratorio clínico comete demasiados errores, el laboratorio será DESCERTIFICADO. Este no es todavía el caso de las instalaciones de pruebas de ADN.

¿Crees que debería haber un conjunto de estándares nacionales para las pruebas de ADN o debería cada estado establecer sus propios estándares?

Incluso si hay una coincidencia perfecta entre los ADN, no puede decir CÓMO llegó allí la muestra que contiene ADN o CUÁNDO. En el O.J. juicio se planteó una pregunta VÁLIDA sobre la posibilidad de que se plantaran pruebas. Lo que hace que esta carga sea tan poderosa es la EXTREMA SENSIBILIDAD del procedimiento. Es decir, NO SERÍA DIFÍCIL para alguien recolectar una pequeña cantidad de sangre (una o dos gotas de un tubo de muestra de sangre), líquido corporal o tejido de una víctima (por ejemplo, cabello en un peine, sangre en un pañuelo de papel, etc. .) y coloque este material donde pueda incriminar a una persona inocente.Hay casos documentados donde se han "plantado" cantidades de drogas, dinero marcado, etc. y personas inocentes condenadas por delitos a causa de estas acciones.

Por último, la sangre que se mezcla con los productos químicos incorrectos o se degrada es difícil de analizar con precisión.

4. Ante la evidencia de ADN, ¿qué preguntas se deben hacer?

Respuesta: Como se indicó anteriormente (y en el juicio de OJ), preguntas sobre el manejo de la evidencia, la calidad de las pruebas, incluidos los controles de calidad utilizados, la habilidad del personal de prueba, la precisión de la interpretación de los datos, la posible contaminación de la evidencia, la posibilidad de una ubicación incorrecta accidental o intencional de la evidencia son preguntas válidas que deben plantearse con respecto a la evidencia de ADN (o cualquier evidencia en ese sentido). A medida que la sensibilidad de esta poderosa técnica mejora y su uso se amplía en todo nuestro sistema judicial, es importante que abordemos estos problemas si esperamos IGUALDAD DE JUSTICIA para todos. No debemos perder de vista el hecho de que no importa cuán poderosa sea una nueva herramienta en la lucha contra el crimen, su eficacia final es tan buena como las personas que la utilizan.

¿Crees que O.J. lo hizo y, de ser así, ¿cómo habría votado basándose únicamente en la evidencia si hubiera sido miembro del jurado?

REACCIÓN EN CADENA DE LA POLIMERASA

La PCR es otro de estos descubrimientos, como el de la estructura del ADN, el factor transformador que determina la naturaleza química del ADN, y las enzimas de restricción, que generó un salto cuántico en la ciencia. Casi el instante después de que se explica la PCR a un científico biológico, las ideas sobre sus usos comienzan a fluir de todos menos de la mente científica más torpe. Incluso hoy, años después de su descubrimiento, todavía estamos desarrollando nuevos usos para la PCR.

La ironía del PCR es que los organismos vivos lo han estado haciendo desde que evolucionaron en la sopa orgánica primitiva de este planeta hace 3.500 millones de años y los científicos han estado al tanto de los DETALLES generales de este proceso para

50 años. Para decirlo de manera sucinta, la PCR hace en el tubo de ensayo lo que cada bacteria hace en su tubo de medio o en una placa de agar y cada uno de nosotros hace todos los días todos producimos miles de millones de copias exactas de nuestro propio ADN AMPLIFICANDO nuestro ADN millones de tiempo. La enzima ADN polimerasa se descubrió en la década de 1950 y desde entonces nuestro conocimiento del proceso ha ido en aumento. Esto significa que miles de científicos han estudiado la replicación del ADN durante 40 años sin caer en la PCR.

El principio básico de la PCR se muestra en la Fig. 15. Se sabe desde hace mucho tiempo que la ADN polimerasa requiere un grupo corto de ADN o ARN llamado PRIMER para "cebar" el COMIENZO DE LA REPLICACIÓN DEL ADN. El genio de Mullis fue que razonó: "Si agrega los siguientes componentes a un tubo de ensayo que contiene una sola molécula de ADN, puede replicar y amplificar esa molécula de ADN muchos millones de veces en poco tiempo.

Una muestra del ADN OBJETIVO que se va a copiar. En teoría, solo se necesita una molécula.

Un conjunto de PRIMERS de ADN monocatenarios cortos (de 15 a 40 bases), en EXCESO, que se unirán a regiones complementarias de las masas opuestas de la molécula de ADN OBJETIVO. Estos cebadores SOPORTAN la región de ADN que se va a amplificar.

Un EXCESO de los trifosfatos de 4 nucleótidos, ATP, GTP, CTP, TTP.

La enzima ADN polimerasa.

Varios tampones y cofactores como los iones de magnesio requeridos por la ADN polimerasa.

El truco final fue conseguir que los dos soportes de ADN objetivo APART (separados) para que los cebadores pudieran unirse y la ADN polimerasa pudiera hacer lo suyo. Había sido conocido por

50 años en los que el calor separa los soportes de ADN y las hebras complementarias se vuelven a unir a través del emparejamiento de bases cuando la temperatura se reduce posteriormente. Así que Mullis calentó su mezcla de ADN objetivo, cebadores y nucleótidos trifosfato a unos 90 o C durante unos minutos para separar el ADN objetivo. Luego bajó la temperatura lo suficiente como para permitir que los cebadores, que eran pequeños y en EXCESO EXTENSO, se unieran (ANNEAL) a sus respectivas secuencias bp de ADN diana complementarias. En este punto, añadió ADN polimerasa y permitió que ocurriera la reacción de polimerización con los nucleótidos trifosfato. Es decir, la ADN polimerasa LLENÓ la porción faltante de cada hebra formando DOS NUEVAS regiones DOBLES DE ADN.

Figura 15. La reacción en cadena de la polimerasa. Para ver otra figura que ilustra la PCR, haga clic aquí y vea el enlace "PCR".

Cada ciclo completo de PCR toma solo de 2 a 10 minutos. Sin embargo, había un problema con el sistema ideado por K. Mullis, que era que la ADN polimerasa que usaba fue DESTRUIDA POR EL PROCESO DE CALENTAMIENTO. Mullis tuvo que agregar una nueva ADN polimerasa para CADA RONDA, lo que requería mucho tiempo y era costoso. Este problema se resolvió utilizando ADN polimerasa RESISTENTE AL CALOR que solo necesitaba agregarse una vez. Las bacterias TERMOFÍLICAS que viven en aguas termales hirviendo se han descrito anteriormente. Este es otro caso de CIENCIA BÁSICA SERENDÍPITA que resulta ser importante. El estudio de los termófilos puede parecer una pérdida de tiempo y dinero para muchas personas, ya que estas bacterias, aunque ciertamente son interesantes, no causan enfermedades en el hombre ni en ninguna otra forma de vida. Se podría argumentar que un científico podría dedicar mejor su tiempo a trabajar en el cáncer o en alguna otra enfermedad terrible que aflija a la humanidad. Sin embargo, resulta que dado que las ADN polimerasas termófilas toleran altas temperaturas (por ejemplo, 90 o C) durante largos períodos sin ser destruidas, son la solución perfecta al problema de la ADN polimerasa de la PCR. Por lo tanto, hoy la PCR se ha convertido en una herramienta revolucionaria gracias a los científicos que estudiaron estos extraños termófilos.

Figura 16. Esta figura representa otra perspectiva de la reacción de PCR. De particular interés es el uso de la PCR para AMPLIFICAR SEGMENTOS DE ADN ESPECÍFICOS dependientes de los PRIMERS EMPLEADOS. Al elegir cebadores con secuencias únicas, uno SOPORTA una longitud conocida (gen (s)) de una molécula de ADN. El segmento entre corchetes se indica mediante líneas discontinuas. Los cebadores rojo y azul, por su ENLACE COMPLEMENTARIO a las secuencias bp en las dos cadenas de ADN parentales respectivas, aseguran que SÓLO se amplificará la porción de ADN entre ellos. Se muestran cinco ciclos de replicación, excepto que el último ciclo está incompleto. Tenga en cuenta que el número de moléculas de ADN aumenta EXPONENCIALMENTE con cada ciclo de replicación.

La reacción de PCR estándar se ejecuta a través de aproximadamente 30 ciclos en un par de horas, lo que da como resultado la amplificación del ADN original en más de 10 9 veces. Por tanto, se puede amplificar una única región de ADN específica para producir cantidades suficientes para hacer cualquier cosa que se pueda hacer con ADN aislado en masa. En el caso de la evidencia del crimen, esto significa que el ADN en un solo folículo piloso, una sola gota de semen o sangre es suficiente para demostrar que un individuo estuvo presente en la escena del crimen. De hecho, cualquier pieza de evidencia que contenga uno o más fragmentos de ADN moderadamente largos (por ejemplo,> 200 pares de bases) puede amplificarse con PCR y su RFLP determinado con fines de identificación, o tal vez para construir un dinosaurio eventualmente. Sin embargo, en la actualidad, el límite máximo de amplificación es de aproximadamente 42 kilobases.

RESUMEN DE LAS HUELLAS DACTILARES DEL ADN

Las principales limitaciones de la toma de huellas dactilares de ADN son el error humano y la calidad de la tecnología utilizada.

El descubrimiento de la PCR aumentó la sensibilidad y la versatilidad de las huellas dactilares del ADN y cambió el rostro de la biología molecular.

Estas técnicas permitirán identificar enfermedades infecciosas en horas o incluso minutos. Están acelerando la velocidad de secuenciación del genoma humano, permiten la investigación de interacciones ecológicas complejas y relaciones de especies que hasta ahora han sido demasiado complejas para estudiar.

BIENVENIDO AL NUEVO MUNDO DE LA INGENIERÍA GENÉTICA SÓLO MANTENGA SUS CINTURONES DE SEGURIDAD ABRIADOS PORQUE VA A SER UN VIAJE SALVAJE.


¿Qué sucede si inyectamos enzimas de restricción en la sangre? - Biología

y los fragmentos más grandes cerca del electrodo negativo.

---------------

Una vez que se ha "corrido" el gel, la única tarea que queda es iluminar los fragmentos de ADN. Con PCR, todo el gel es simplemente

empapado en una solución colorante. Los fragmentos de ADN aparecen como pequeñas bandas en el gel y podemos determinar su

longitud por su posición en el gel. Para iluminar el perfil de ADN de un análisis RFLP, primero debemos exponerlo a

sondas marcadas radiactivamente, que se dirigen específicamente a las secuencias de STR que estamos tratando de encontrar. Entonces podemos exponer

a una película de rayos X, que visualizará solo los fragmentos que fueron detectados por las sondas marcadas radiactivamente. Mientras tanto

Como se utilizan las mismas técnicas para preparar todas las muestras en una prueba, una comparación directa de los perfiles de ADN es una

forma precisa de hacer coincidir identidades o confirmar relaciones. El perfil de ADN de una persona será aproximadamente 50/50

combinación de su madre y su padre. Una coincidencia exacta del perfil de ADN indica que ambas muestras fueron


Ver el vídeo: Clonación Molecular - Enzimas de Restricción (Mayo 2022).